Description :
From Genome Similarity Track
Location :
Scaffold_24:179810- 181446
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06255PREDICTED: uncharacterized protein LOC101247317

Sequence
1636 bases(100 bases per row)
ATCTCAACGGCTGCCGGGACCCACAGCTGAAAGTTGTACAGCAGGTTCTTCTGGATGTCATCACTGAGGTACCGGTCCGACGCCACCGCGCTCAAGAGCC
GCTCGACCGTGCTCAGTAAATCGGGCGTCAAGTACGTCGTCGGAAGCGATCGCAACAATAGCGCAAGCAGAGGAATCGTTTGGCTACGGCGACACACAAA
CTAGGCAGCAGTTTACATGAGATACAAAATCACGCTTGCTTGCACCTTGTTGATCGTCGAATGGCGAAGGGTCTCGGCGAGAAGTGAGATCATCTTGGGG
ATCGAGAGCGGCCCAAGCGGGCGCGTGATGGTTTGGCACGCATTGAGGTCCAGCGGTCCGGCTTCGGCCAGCGGCGACACAAAGAGCGGCAAAAAGATCA
TCGGGCCGCCCATCTGCCACACCGAGTCCTTGAACGTCGAGATTGTCCGCAGGCGCACGGACGGAGCAGACCCGATGTTCTCGCCATGGTGCATGTTGCC
GCTCGCGTCCAAAAGCAGCTTGTGCTTCTCGTCGTAGCTCCGCGCATCAAAGGCAAAGACGAGGCCTTCGTGGGGTGCCCCGGCCGATGTTGGCGCCGAC
GGAGCTGCGGCCGCGCTCCCTCTACACACAGTATCAAGTCTCGATGACAACACGGCGGGAGCGCGTACCCAGAAAGCGGCGCCGACGCCGTGAGCGACGA
CGACATCACGGCAGCGTTAAACTGCAAAACGACATTATCGTAGTCGTCGGCCGATTTGATGCTAGCGCAGAGAACCTTTAGATACAAGAGGTATCTTGAT
GGCGATGTACCCTTCGAGGACCGAGGCAGCAAGCGGCTGCGAGAAGAACGCGATGGACCCGACGTGCGCGATGAGGCACCGGCTGTAGTTGTTCTTGGTG
CGCCCCACGTAGCACTTCATCTTGGTGCCTGGCGTCGTCGCAATCGCCGGGTAGCCAAACCGGAACGACTGGCGCGCGTCACCGTTGACATACACGTCGA
GCTTGGACCCGCGGAACTGACGGTACGTGTGCACGATGCAGATCCATTGCCTGCAAGGACACTTGAATCAGAGAGGCAGCTATGCAGGGCGAGTACCATT
GGTGCTTGACGAGAGCGTTGGGCACTTGAGCTTCGTTGTACTCGTTCTTCTTGACATCCAAGCTCTTGACGACGAGCGTCGTGTCCATAAAGCTCACTTC
GACCCCGACGTTGCCTTCGGTGCTAAGTAGATAAGCATGAGGATACCAGCAATCGCACTCCTTCTTCTCAATACCAAAACGAAAACAGGGGCGAGTTCAT
CCCTGGCGAAGACTCGACGCGGATCCACGTCGAGAGCGTGTAGCCGGACGGCGGGAACGTGACCGTCTCCATCGAGGGCACGACAAAGCCCGACTGGTCG
CCCGAGAGGTCGAGGTACCACGACGGCCCTGGCGCGCTCCGGGCCATCATTTCCATGGACGCGATAAAGGTCGCGACCGCGTTGTCGTCGGGGGCCACGT
CCTTCCAACTACGCATGATCATTGAGACTGCGACTTCAAGTATGAGGAGCAGTGTACCGCGGCGACTGGAACACCTGCAGCATCGCGCGGATATCGTCGG
CCGTCACCGAGTACTGCGCAATCTGCATCAAGAGCG