Description :
From Genome Similarity Track
Location :
Scaffold_82:179767- 182679
Transcript NameFunction/comments
Physo_140141hypothetical protein

Sequence
2912 bases(100 bases per row)
ACGTCGCAGTACACGTGGTGGAGCTTCGTGCCCGTGTTCCTGTACCTGACGTTCCAGAAGACGGCCAACCTGTACTTCCTGCTCATCGGCATCTTCCAGA
TCATCCCTTCCGTCTCGCCGACGAACGGCGTCCCGCTGCAGTTCATCCCTCTGGCCATCGTGATCGTCATCGACGCCATCTTCGCCGGCTACGAAGACTA
CAAGCGCCACATGGCCGACGACCTCGCCAACTCGGCCAAGACGCGGGTGTTCAACCGCCAGCTGCGCGAGTTCGAGGAGGTCGAGTGGCGCGAGGTGAAG
GTGGGCGACTTCGTCAAGGTCGCCAACCACGAGATCCTGCCGGCCGACATCATGATTCTGGCTGTGATTCCTGCGGAAGGAGCGCGCTCCGGCGGCAATA
TGGGCCTCTGCTACGTGGAAACCAAGAACCTCGACGGCGAGACGAACCTCAAGCTGCGTGAGGCGCCCCAGCCCACCCGGAACATGTTCATGAACGAGGA
TGAAGCCGGCTACATTGTCCAAGGATACGTAGAGAGCGAGCTTCCGAACGGCGACATCAACACGTACTCGGGCTCGCTCTACCTGGAGGAGAACCCGAAC
GGGGGCAGCAATGAAGGGATCCCCCTGTCGCTGAAGAACATGCTGCTGCGCGGCAGCAAGCTCCGCAACACCAGCTACGTGTACGGCTTGGTGGTAAACA
CGGGCATCGACTCCAAGATTATGATGAGCTCAGGCGATGAGTTCCCGGTCAAGGTCTCGTCTATCGATGAGATGACCAACAGACAGGTGATCGTTGTGGT
TGTTATTCTGGTGGTGATGTCGCTTATCGGCGCGATCGGAGACAGAGTGTGGATGAACGGCCTTCATGTTCCAACGTACTTGGAATTGACCAGCTGGGAC
GACAGCTTCATGGAGACTTTCGTGTACTTCTTCGCGACGCTGGCTTCGATGGTGCCCATTACGCTGTACGTGTCCATTACACTCGTGAAGGCGTTGCAAG
GCTACTTCATGGAGCGTGATCTGGACATGTACGACGAAGAGACTGCCACTCCGATGAGCGTCCGCAACATGCAGCTGAACGAGCAGCTGGGCCAGATTTC
CCACATTTTCTCCGACAAGACGGGCACTCTGACCTGCAACAAGATGGAGTTCCGCAAGTGCAGTATTGGTGGTCGCAGTTACGGCAAGGGCACGACCGCT
ATTGGTATCGCAGCTCGGATGCGGAGCGATTTCAAGGGTGACCGGACCGTGGATGAAGACACCGCAGACGAGAATGATGTCTCTCTCTTGGATCCACGCA
TGGAGGCCCCAGCTCCTAACGTGAATTTCAAGGATAAAAACTTCTGGCGGGATATGCAGAACAAGGAAGACACCCAGAGCGGGAAGATCGAAGAGTTTAT
GACCTTGTTGGCGTTGTGCCACGGTGTTTTGATTGAGCGTCTGGACCCGACGGAAGAAGATGCCAGCCCTCCAGTTCACTACTCGGCCTCCTCTCCTGAC
GAGCTTGCGCTGGTCTGCGGTGCCAAGTACTTCGGCTACGAATTCATCGACCGCCAACCTGGAAGTGTTTCGATCAAGAAGCCTGATGGAGTCGTGGACC
AGTACGACATTCTGGAAGTTTTCGAGTTCGACTCGAACCGTAAGCGTATGTCTGTGATCGTGCAGCGTCGGAAGCGTGATGATGAACTCCGTCTCATGTC
GGAAAGCGAGGAAGATGACGTGCTTCTTCTTACCAAGGGCGCTGATAGCATGCTGTTCCCTCGTCTTGCTCCGATGTCGGCCAACAACGACCGGATCCGC
GAATCAACAGAGAAGCACCTAGAGTCCTTCGCACAAGATGGACTTCGAACGCTGGTTGTTTGCGCGAAGAAAATCAGTCCTCAGTCTTGGGAGCAATTCT
ACGCCCAGTATCGCCACGTGTCTGCTGACCTGAGCCAAGTCGAGGCGAAGTCCAAGGGAGAGCCGAATGCCATCGATGCTCTGCAGGATGAGATGGAATC
GAACCTGGAGTTGCTCGGTGCCACTGCTATCGAAGACCGACTGCAAGACGGTGTGCCTGAAACGATGGAGAGTCTAGCCAAGGCTGGAATCTGCATCTGG
GTGCTGACGGGAGACATGGAGGAAACGGCAATCAACATCGGATATGCTTGCCGCTTGCTCAACAACGACATGGAACGACACGTGATTAATGCGGCGAAGT
ACCGAACGAAGGGCGCCATTCTGCGCAAGCTGGACGAGATTTTCCACGAGATTCACGACGCTAGTGACGATGCTTCTCGTACGTCAACGGTGGCTGCCCA
TTCCGTCTTGTCTCCGCCATCAGGCCAAGTTGAGCACGCTCTGGTGATTGACGGAGCTTCACTGAGCAAGATTCTCGAGGACCCGCTGCACAACTTGCAT
CTGCTGCGTGTGTCGCTGCTGTGCAAGGTCGTCGTGGCTTGCCGTGTGTCGCCTCAGCAGAAGGCACAGCTGGTCGAGCTGGTGAAGTTGAATGTGCCGG
AATCGCACACTCTTTCCATTGGTGACGGAGCTAACGACGTCCCGATGATTCAGAGTGCACACATTGGTGTCGGTATCAGCGGGCAGGAGGGTCTGCAAGC
CGTGAACAGCTCGGACTACGCATTGGGCCAGTTCCGCTTCCTGAGCAACTTGATTTTGGTCCACGGTCGCTGGAACTACAACCGCGTTGCAGCTCTGGTC
GTCTACACGTTCTACAAGAACATCGCGTACAACGTGTCCATGTTCTGGCACACGCTGTGGCCTACCGGGTATTCCGGTACGATGATTTACTCCGCGCTGA
TCCAGCAGGGCTACAATCTGTTCTTCACTGCGCTCCCGATCGTCGTGTTCTCGGCGTATGACAAGGATTTACCGAAGAAGACGGTGCTCGAGTTCCCGAC
GCTTTATCACGC