Description :
From Genome Similarity Track
Location :
contig_47:179734- 182060
Transcript NameFunction/comments
g7841.t1hypothetical protein

Sequence
2326 bases(100 bases per row)
CTGATGAGCTTAATAGAACAACGCGATCCGAGGAAGCACCGGTCGATGACCCTCCTGCATCTACTGAAGGCAGCTCTGCAAAAGAACGAAGTTCGTCGCT
TCCACAGGACAACCGAGACATCCTTAGTCTGCAAACCAATGTAACGCGTTCGGCTTCTGGATCCCTGTTGTTACATAGGAGATCCTCGACGACAAAAGTA
CTCACGCTGAAATTGCGTCAGAAGTCAAGTAGCATGAAGCTGCCACCAGTAGCGCAGGATGACTCAACATCGGAACCAAGGCCACTCTCGCTTGCTAGTT
CTGGCTCGAGTAGTAAGAAGTCACTAAACCGTCACCCAAAAAGCCTGAGTGCAGGGGTAACATCAGTCCCACCGAGAAAAGCGCAAGGGTATTGCTTTCT
GCAGTGTCTCCGATCAAAGAGAACGAGGGTTTATCAAATTCAAAGGAATACCGGAGCGACTTGCGTCGCTGCGGGCGCATCCGAACGGAGAAGGCCGACA
ACATCATTAATTCCTCTAAGAATGGCCCTGTTGGAGCATCTAACGGCGCCACAGCAAACGCAGCCACGATATGGGACCCCGTGCATGGTGTGTGTCAGCC
TTTTGCCGTTTTGGGGTTCATGAAGGAGCAAACAGCTCGACCAGCGTCGAGAGGATTATCCTTGTCGTTATCGTCAGCCAAGTTGGGCAGATCTGCGAAG
TCAGCTGCCGATCATCTCCGTAAAGCTGCAGTCACTGCTGCAATCGCTTCGGGGCACACAGAGTTCACACGCTTCCGCATCTTTGGGAAATTCCGTGACG
TTGACGATGCGCTCAACCTGTTCCGACAGATCTGCGCTGTAGAGAAGACCCCGAAATTATCAGAAGGCCAAGACTGCAGTCGGTTCGCGGTCTACAAAGA
GGACGAGATGACGATGGCACTGGAAAACTTCCCGAGTGTCGACATTAGGGACGCAGGACACAACCAGTTCAGTGCGGCGGACCTGCCGCAAGCTACGGGC
CAGCGATTCGCGTGCGTCAGCGTCTCCCTTCAGTCCACTGGAGCCTCCTGCATCGAGTCAATTGTAGTGCACGTGTACCAGTGTTTCCCCACTCCCCAGA
GCGCCGTGAGGTTCGCTCGACAAGTGGCTGCAACACTTTTGGCTCCGAGCGCGCTGAGCATCGTGCCGTTGTTCGAGTGGATCGCCTTGGCAGAACTGGA
GCGATTCGACGCTCGCAACAACGACCTGGAGCAGGAATTGGAACTCGCTATGCGTCGCGGGGGCAGGAGAGCACGTGGAAGGCCAGGAAGGAGGCTCTCA
AGAAAGGCGTCCGACAAAGCAAGTTGAAGTTGGCTTCAACATGATTTTTGCAGTGTAACGTAATATTCGCAATAACACATTTTCATTTTCTCTTCTCTTG
CTAGACGCTTGCAATGGCTCCCCGTACGGCTGTGACGCTCAACATCTACGACCTGGTGGAGGCCAACGAGTTCATAGCGCGTACGTGTGTGCGTGCGCAA
GATGTCCAGCTGTGTGTTGCCTAATTATCGCCATGGGATTCCAGCGCTGGGGCTCGGCATCTTCCACAGCGGCATCGAGATCGCAGGAGAGGAATTTTCC
TACGCGAGCGGCGCCGGAATCTTCTCGTCGAGCCCCAAACAAGCACCCGGTAACCAGCGACTACATATTTGCCATTGTAATATGTACTGGTATTCAATTG
ATTGCCTTGTGACTGCAGGCGCCAAGTTTCGGGAGTCTGTGGCCATGGGGTTCTTCGACGGAAGCTTCCAGGAGGCCCATCGCCTCGCCTACTCCCTGAG
CTCGGACTTTGAGGGAGGAGCCTACAACCTCTTCACCAAGTACTGTAGTCCACAGCGATATATTCGTTAGACACAAGGCACTGAAAGTCTCACTTGTGAG
TTGATTTATTTCTCTACCTGCAGGAACTGTAACTCATACGCGGACGCTTTGTGCCAACTGTTGCTCGGGAAGCCCATCCCGGCCTACGTGAATCGAGCGG
CTTACTTGGGCTCGTTCCTGAGCTGCCTCATGCCGGCGGACCTGGCGGACCAAGCGCCCGTGGGAGACCCCAACACGCCCTCGCGACTCACGAATGGCAG
CCCACAACGCTCGGACTTTGTCTACACGCCATTTGCTGGTGCGTTTGCTGCAGTAGTTTGATAATATTTGGACGGGCGGCAGTGCTAACGCCAATCGGGT
CAATGTGTAGGTTCTGGACAAAGTATGGGCAGCACTGCGGACTCCTCAGCGTCTTCGGAGTCATCGTCACTGGCAGATCGTCGCGAGAAAGTTCGCCTGG
CAGCTTTGCGGCGAATGGGCGAGCCA