Description :
From Genome Similarity Track
Location :
Scaffold_317:17971- 19348
Sequence
1377 bases(100 bases per row)
GCCAAGAGAGTGTAGCAGACTTTCAGCAATTGTAACAGCGCGACTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCATTCTCCTTTAGTACGCGTCCGC
AGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGTTGCATCAATGTACTGCTCAGTGCCCAGTCATTGGCGTACAACATTATGTGGACTTCTTTCGCCGA
GTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGACGCTTTTGCTGACGCCAAGTCACCCCCAGGACCAAAGTCCGTA
TCTTTAGCTAATAGAGTACTGCTCCGTAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCCCCTTCTTTGAT
TTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGTTGGA
TAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTCCCCTCC
AAAACAGATATCATCGACAAACGACCTCCGCTTGAGCACCGGAATCAAGGAAGACTGGTCAGGTTCTCCATCAGCAAACATGTCGCCGTCCGGTCCATTG
ACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGACTCCGTCGAGCTCGA
CTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGCTCGGCAAACAGTTGCCATCCTCCCTTTGATTGAACGTATCCCCATAGAGCGTTGTCGAT
TAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAATGGCATTCGTAACCATTCAAAGTGTCCAAGTGCACATACGAACGCTGAGATCTGCCGAGCT
CGGCGTGTCATCAAGACTGCCCAGAATCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAGCTTTCCAATTCGGTAAGCAGGTCATCAACCAGTGGCA
TAGCGTATTCCATCGGTGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGTCGAATATCCCTATTATTTTTCTTGAGCACTATCACCACTGGCGA
GGCCCAAGGGCTGCTCGAGAATGATATCAACCCAGCTCGAAGCAGCCCCTTCAACAACTCGTAAAGTTTGCTCAAGTGGCGGAGAGGTATCCGCCGAGCT
CTCTGCTTAATGGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATTACC