Description :
From Genome Similarity Track
Location :
Scaffold_793:1797- 2858
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_793-fgenesh-gene-0.2DNA excision repair protein ERCC-6

Sequence
1061 bases(100 bases per row)
CCTCGATCGTACCGCTCGTGATGAGCCTGTAGATCGTCACTTGCTTCGTCTGGCCAAGACGCCAGGACCGCTCCCGCGCCTGAAGGTCTGTCGATGGGTT
CCAGTCCGGATCAAAGATCACGACACGGTCAGCGCCAATCAAGTTGATGCCGATGCCACCGGCGCGAGTCGTGAGCAGGAAGATGAAGATCTTGCTGCCG
TCAGCGTTGAATGCGTCCAGCAGCGACTGCCGCTCCTTGACGCTCGTGGTGCCGTCCAGACGGCAGAAGCAGTAGCCCAGTCGCGCCATGAGGCTCTCGA
GGATGTCGAGCATCTTGCGCGTCTGCGAGAAGAGCAGCACGCGGTGGCCCTGCTCCTTCCACATACCCAGGATCTTGCTCAGCACGAGCATCTTCCCGCT
GCCTTCAGGTGCTCCGTAGTCTTCGATATCGTTGCTCACTGCTCTATAGGCCGCTGCGCCATTATCGCCTACGGTTGCCAGCAAGTCTGGATGGTTGCAA
ATGTGCCGCAGGATGGAGATCGCGCGGAATGGACGAATGTCTCGTCGAAGCACAGACGCCACCTCGGACGAGTTGAGGTACGTTTGGTAGGCACTGCGCT
GTTGTGGCGTGAGGCTGCAAAATATGATCTGCTCCATCTTCTCAGGCATCTTGGTCACGTGTTGAATTTCCTTCTTGGTCCGCCGCAGCAGGTACGGGTT
GATGAGATCCTTCAGCACCAGTGCGCACTTGTACGCCATCAGCACCTGCATCTTGGACGCGTTCGCGTACCCGCCCGTGCGAATGGGCAGCACGAACTCG
TCGTCAAAGGTCGGCAGCGTGCCCAGTTTTCCTGGATACACGAAGTCAAAGAGCGACCAGAGCTCGCGCAGACGGTTCTGGATCGGCGTGCCCGTGAGGA
TAATGCGGTGCACCGTCTTAAGCTGTTTGCACACGAGCGTGATCTCGGCGTCCGGGTTGCGGATTCGGTGGCCCTCGTCGAGCACCACGTAGTCCCACTC
AACGTCCATGAAGAGTTCCTGGTACTGGCGCACGTTCTCGTACGTGGATATCACGACGCCG