Description :
From Genome Similarity Track
Location :
Scaffold_322:17967- 27211
Transcript NameFunction/comments
Phyag_g4654hypothetical protein

Sequence
9244 bases(100 bases per row)
GTGCTAGAGCAATGAATAAGATACCTTTGGCAACAGGCTGGGGTCCACGACAAACGCATACATAATAGCAGCATTGCTCAATGCAAAGAGCATCTCGGAC
GAATACGTCCACGTCGGCAAGACGCCAATCGACATCAAATGTCGACACACCACATCCAGCATGCGCACGAAAATGTAGAGCGAGATGGTGCTCCGTCTCG
ACGGggagtccagcagcagcgccgaccCAGAAACAGCGCCTGCAATTGCCAAATTCACTGCATCTCGTTGTCCGCCTCTCGCCGCTCGTGTCACCAGCTC
CGTGACTCGAAAGATCCCCACCAAACTGCCGAAAAAAGCTCCAAAGCGGAGTGTGTCCCCTCTCAGCAACAACCTAGCCGCGTCAGCATAGCCGTACTCG
AGACTGCTCCACTTCCTGGAGGCCAATAGAACTGCAGTGAAGGCTTTGGCTCCGTAGGCCAATAGGAACGCTCTGGCTGCCGCTTGACACGCCGCCTCGA
GATCTTTCCTGACGCTCATCCAGtccatcgtcatcttgtGCAGTTCTTGACGTCTGGCGGCTGCGTGGCGTTTGGATTCATGTGGAGATTCctcttctgc
atctcggtTGGTGTCGGGCTTCCGCCGGTTTGCGTCATTCCCAGTAGCAGgacgcagcaatggcaaAGGCGGAGGTTTCTGAGTCTTCTGCGTCTCGttg
tgcagctccagcgctgcgGCCGTGAGCTCTGGCGGCTCGCGACGTCGGTCGGTcgtgaagaaggccgagTAGATGCGCTCCATTGTTGATAGGACCTCCT
TCTCTCAGAAGATAACGATGGTCGACGTCGACTTAATGATGACGAGTTGAAGCTTGGATGGAATGTGAGCACGTCGGGTCGAACCTGTCGTGTAACCGGT
TCTGTACCGGTATTATTAATGTGACCACACGCAAAGCCCACACCAATGATACGCAAAATGAGGTTGAAGTGGGCGGATCGCAAATCTCGGTGGACGGTGG
CATGGAGTGTCGATGTGGTACTGCGCACCGTGACGGTGACGAAAGCTACTTGCCCGCTACTGAACTACTACATTACATTCATCTGCCTATAAACTCCTAT
CAATTCTGCCTGCGGTACTTCCTTCACCATCGGCTATGACAGTTTACTCCTACTTTGCGCCAACAGACTGGGCCTTGATACGTATATACTACTTCTCGAC
ACAGTCACATCAACCGCGGGTTCCGGCCAAACGCATTCCCACTGCTATAGCTTCCATGTGACAACACCGAGGTAGCGTTCAGATTCGCATTGTATCGACT
TCGGTTGCTATTCTCGTTCTCACTTGGAGCAAACCGAACCGAAGAAAGCGAATGCAACCTGCACAGCGCACAAGGAGAGTCCTGACAGCTTATCTGATGC
AATCTGCACCAATCGTTACCCACAGCAAATTTATCGCAAAACTCGTGACGGCATCTTCGAGCCATCGCGTGGCTTGCGCAACCGCTACTGTTCCGCTCAG
CGCTGTACATGCAGCCTTCGTAGGCGCACTGCTGCCGAAATGCGTGAAATTCACAGAACTGGTGGCAATCCACGAGATTTTCACACCCTGGCTGCCAGCA
AAACGTCGCTTTGGAGTGGGCCAAGCACAAGAGAGAACCACTGCCTGCAATCTGCGAGCAACTAGGAAATCGACACGCTATAGTGGGTTGAGAGAATCCA
ATCTGTTGCACTGCAGGAACGTAGTTACTTGTCGGCCCACTCATCGTAACTTCAGGTTGTGATTGGACATCCTCTTGCAGGCGATAGTGACGCTTACACA
AGTTTCGCTTCTGGGCCTGCTTATCACATCCTTCAACTTTGCAGTAGTATCTTTTCGACTTGCTGGACAAGGGACTTGATTGCTTCGACTcagctgccgc
agctgcgACGGCTGCGGCTTCCGCCAATTCCTgttcacgctgctgttgttgcgCTTGAGAGTCCAGTTTTAAATTATCCACAGACAATGCCCCTGTCTTG
AAAGCCCGAAGATGAGTTGCGCACAATCCACCACGGACGCAATCTTGGTCGCAATTGCTCACGCGGCACAACAAGGCCTTTTCTTCAGGTTGGGCCATAC
CACTACCTGCAGGGTTGAGCGGGTGTTCCTGTGAACTGGCAGGCAGTGGATTTATGGCTACCACAAGTGGTGAGAATAGTCTTTGACAAGCCTCACAATA
ATCACGGCCGTAACTCTCCCGGTCGCACATAGGATTCGTGCACTTTGTGTGGGTAGTGTTCGTCATCGTACCCACACCGGCTGAAATCGGGACACGAGTG
ACTTGTGGCTTCTCGCTTACGAAAAATAATCCCGGCTTAGCTTCATTACCAACGTCATCCGGAAAGAGACGCTCACTTTCACCAGACGAGAAAGAATTTA
CAAGACGCCCTTGGCTTTGGGAGTGGTTTTGGTTTTCCTTGGTATGTTCCACGCACAACCCAGCAGCATACGACAAGTTCCCACAACCTGGCTTTCCGCA
ACGAATCTGCTCAACTGGTCGAACATCACTACCGCCACTGGCTTCAGTTTCTCGTTGTCTTGGACCAGTTTGGTCCTTCGAAGCTTTCCCTGAACTCGGA
GCTGAACCATCCTTTTGGAGATTGTGTAGTTCATAGTAGTGCATCGTGCACAATCGATCTCGCTGCGAGTTTTTGGTGCAGTTTTCGTGCGTGCAACGAC
GGATATCCTTCTGCATTCTCTCTAAAATTTCGTCGTAGCTCTCAGTGGCTGCAGGTCGATCAGCTAATTCCTTGGCCTGCTTAATGATCAGGTTTCCATG
GGTTCGGCACAGGTGATTCCGCTGCGAATGCTTGGTACACTCAGGATAGCTGCACATGGTGTACGCACTATTGAGGCGACGCTTATTGATGTGTGGAGGC
AGACGTCCTGTAGCCATCAATAACTTTTCATGACCACGACAGTATCCTCGGCCTTGGTCGTTCTTGAAGCACCCGGACATCTTGCACACCGGCACATTTT
GCGTGCGAGCATCCAAAATCTCTTGCAGTGGTTTCTTGCCCAGCTCCATGTGCTTCGTGCACATCGCAGCTCGCTCCATAGCCTTCTCCCGACATCCTGG
AAAGCCACAAGGAGCGACGATCACGTGTCGGTTGCAGAACGTGCCATACGACTGGGACACTCGAGCCCGGTTCGGACACTCGGGGAACTGGCACCTCTCG
TTCCGGTCTTTGGTGAGTAATTCCGTCGCTAGGTCGGGCGCATCAGTTGATTCGTTGAATTGTGTGTACGCTGCGTCCACCAAGGCCACCATCGCTGGAT
CAGCTGAAGCTGGGGTGGTCGATTTCTTAGCCTTCGTCGTAAAAGTCGTCGGTTCTGGTACAGTCTTATGGGAGGCACCTGAATCCCCTTCTGAGACCCC
CGATGTCCCCGCCAAGCCGTCGTGGAACGAGTTGACGTCGAAGCCCATTTCGGACGCAGCTTCGGACGGGGCCCCTCCAGCTGTTCCGTCGTTCCTGTCT
CTGGTCGCGTTGGTGTCCATCATGTCGAACTCCCCCAAGTCTAAACTGCCGCCGTGGCGACGCTCCTGTCTCGCATCGTAacctgaagttgaagtcgacg
taTCCGATGCCTGCCAGTAGTTtccctgttgctgctgactgtaggtccgagcagcagcaggttccaTCGCCATTGGGTACTGCAGGAAGCTCgacgtttg
ctgctgctgctgctgtggctgggGCTGGTACGTGGTTCCACTTTGGGTCGCGTACAGGTTCATGACCGACCGTTGGAGCCCCTGTCCTCCGCCGCCTGTA
TCTCTAGgctgttgccgctgctgcatACTGGAGCTAATCTTATTCTCCTGGAATGATGCTAGCTAGTGAGCACGCGAGAGATTGCGTgggtggcgttggc
tgcagtggcgacgacgaagatgaggcTATGGGTGGAGACTGCGATTGTTTATCTTGCTCTGGGTATCACCGCTGTTCTTCTCGCCACTCACTTGGTCACC
GGCAATTGGACAAAATCCAAGAGGGAAAAAGCTCCGAGGTGAAACTCATCGTGGACCGCTCGGTCCAAAAGAAACCGCACCATCAACGAAAGTGTCGGTG
GCGGCAATTGGTTAGAGCGTCAGTAGCGATGGCTGGTGAGATTCAGCTCGGTATtgctacagcagcagtgtTTAGCGCGCGAGAAGATTCGATGGGCGCT
GCGTGCAAGGCGAGAatcgcagcggcggcggccgcggcaggaggagacgcgttctgcatggccacgccggcgttgaccagctccatggccttatcgcaga
gcttcttctgctggcgCAGCGGCTTGCTGTACTGCATGgcatcatcgctgtcgccgtcgctgccggaACGCGCCTTGGTGCGCGGGCTGCGGGGGAAGCC
ATTGTTGATACATTCGACACGAAAAAAATGGAAGCATGATGTAAAATCGGTGGCGCCAAGCGTCCTGTCTCTCAGAAGACCTCATGCAGCTTCAGAAAGC
GACCGAGCAAGGTCCACGAGGATGGCAAGCACTAGCAGGAAGGCCGCAAACAGCAGAGCGTGCTTGCAGACCGGCTTGCAGTctgcagcgcagcaaacAC
AGAAAGATGCTTTTTTCAGGACATTTTCACTGCGACCTTTAGTCAACACATggcggctgctgccacaTAGCATGTGCTAAAGACGGGATCGAGTAATAAC
TTCAACTCGGGAACTGTTAATCCTACTCGACAAAACTGTTATTCTCACTAGACAAGTACCAATTATTTGGTACATCAGTCTGTAGCAGTAGGATTTTATT
AAACAGTGTATGCCACCCCACTAGACAAGACAAGCTAACATGTGCTACGTAATAATAATTTTTTATCAGCACGATGCTCGCAGAGAAGATCGTCCATTAT
TGAGGTTGTCTGCCAACCGTTACCATTATATtatcctcctcctccttcttaCCACCCTATATTATCCCTCATCTTCTCTTTTTTCGACTATTTCAATAAT
ACTTCTTGATctctttctccttcatcttcttcttttcctcctcctcctcctcctcctcctccgtctcttATTCGTCCTCCTCTAACTCCTCTTACTCTTC
CTCCCaatcctcctcctcctcttaCTCCCCCTCCCCCTCTTTTTCCTattcctcctgcttctcctccaatcCATTGTTCATTTCATACATATTATTATTA
AAGAGTCTGCGTTAATTCGAAAGCTGAAGAGGCTAACAATGCTGTCATCCTCCACTCTTTCACAGACCGAATGACCTAGCGAACTGTATCCCGTCGTATG
TTCCTTTGTCGTATTGGTAGTTTTGCCTTGATTGCTAGTTCGGGGAGTGCTATGAATGCTAGTTCGGGGAGCTGTCGACACATTACGTTCGAAAGCACTC
AAGCCTCGACGCGTTCCTGACACCCCACACCCTTTCTTGTGCGACTTCTTGTGTATTTTGTTATTCGCTCGCCGTGTTTTGATGTCAGGCTCGAAGATCA
CCGCTCGGGGAGGCGGTGGCTCAGTAAACCTGTCGATTTTCCAGTGTACGTGAAAATCTGAAGCCAACAGCGAtttcccttcttcttttAGTTGTTTTAG
ACGGTGTGCGCACGGAAGTCCTGTCGAATGTGTATACACCCCGCTGCATAGATTAGAGGTATCTGTCGCCAATAATTCCAGACGCATAAGCAACGCATGT
TTGTGAATCACCTTCACAATGTTAACGAACAATGGCCCTCTTAAAGGCTTTGGCACCCGAATGGCTTCGTTGGAGACTGCCTCGTTATGCGTCTTAATCG
AGAGACGCCACCAGTTTTTCATCGTCTAGTACATTTTTAATAAATCCCCTCTTGACTGAAGCCAGCCTTTCAAAGCAGAGTGATATCCTTCCATTCGTGA
TGTTGCGTACATATCAAAATGGACGAGTCTATTTGTCCAACATCGGACAAAACGCATTTTCCGCGTATTAAGCCACACATCATCGATATACAAAGCTTCG
GTAGGACACAGTTGATGTAGTTCCTTGTGCAAAAATTCGTATTCATCTGGCGACGATGAGTTCACAAGGACCTTGAAGGTATCACAAAACACATCAAGCT
TCACTTCGTCCAGAACTCTAACCTTCTTTGTCTGCTTCGATTTCCGTGTACTGGTTGCTTTTTTTGCTGAAGCACCCTTCGCGTGATTTCGTATGTCCAT
TAAAATATGCCAAACACACAGTAACACTGGCACTTCCGGGAAAATTGCTTCTAGCGCGTTCATTAGGGCCAAATCACAGTCGGTCATTGTTCGGTGTCGC
CTTCAAAGTAAATGTAGAAGTGAGTTCATTCACCGCACTTTAGAACGAACCAGAAATGCACGCCTTCGATTGGCCCTCTTCGGTCGAGGACGACTCGGCC
AAAGATACTggttgcagcacttgctggGCTTGATTCCTGCAACGAGCTGAACCTGTAGCAACCGCTACAATAGTCATGAAAACTTGTGGAAAAGAAATAT
TTTCCGATTCCATAAGCCGCCTAAGTTGGTCCAGCGACCAACTGTAGTCCTCGTTAGTCTCACCGCGGAGGAATGCCTGCGCCAAGTGGATGGTAGTATT
CATACCAGTTACACCCACCATGTTCAAAAGTGGCATATCGAAGACATTTGTCTTGTAAGTGCAGTCCAACAGTATGACATCTGGATTCGCCTTGAATATT
TTTACGGCCTCCCTAAGAGCAAAGAATATGTGCGAAATCTGCTGAACGTTATTCACTTTatgcgagaagaagcggtcGTTGGTGGACAGAATAGAAAAAA
GGTTGTCAATCCGTGacttttcttcatcaaaattggctggacgagctgtttGTCGAATGGTGTGAACGTCTGTCATCGAGatggcgctgttgttgtcggc
TTCTAGAATGCGAGACATAGTGCGGGATGGTTTGATCCCAAGTTGTGCATCGAGAATAATGGACTGACGAATCTCGGGTGTGAGGTCAACTCTACGATCC
ACCGGATGTGAAAAAGCGCTTGTAGAGGGGGCATGGTTATGAATAAACTCACTACCATCGAATTTGAGATACCAAGGTAGGGATTTATCGTAGTGCACAT
GCCATTGGCCAGTTCCCTGGTTGAGGTACAAATTGATCCTCATGGTACAGCCACATTTCCGAGACGCAGCATTCGGGCGCCGTTTTGTACCTGCCCGCGG
TTTATGGTCATCTTTGTAGTTTCCGTGACGATCACACGCGAATACAACGCGGTATTTCACTTTTTGGCGATCCAGTATTGAGCGTAAGTTCACGAGAGCG
TACCCATGCTCCCTAGCGAAATTATTCATCAAGTCTTTCGCTGCTTCAGGTGACGTGAAATTCTGAACAGGAGGAACGGGGACCGCAAGCGAATTTGTTT
GGGCAGAACCAGTAGAAATTGCGTTTTCTACCCTTTCTTCGATTTGGCCGACAGTAAAAGGCGTTTGCCGTGGTTCTCTACTCACCTGTAGGTTACTGGC
AGTTGATGCGTTCGCGATACCTTCACTAGCGAAAATTACCTTCGGCGAACCAGATAAAATATCTTCATGAAGCACTTGGGTTGAAGAAACACCATCGCGA
ATCGTGAATAGAGTGTCGGATAACAGGGCGCCCACCGAAGATTTCTCACCAAAGGTTTCTTCACCAAATCTAGAGCTTGCACGTGAACAATATGCTGAAC
AAGGTGTTTCACACGAACAATTTTCCGCATTCGTTAATCCACCTGCTAAACCACCACCGTTACCACTCCCATTCAAATGTCTGCAACGACAGCCTATTTC
ACGATGGTCAGGACATTGGCGGGCTCCTCAATCAGAGGTATCCAGGTTTTCCGACCAGGAGTTGCTTGTCGGACACTACTCGGGTGTCCGCGCGTCGTTA
TCTGAACCGACCCTGCTTAATCcgttcacagcagcaagtactGTAGATGGAAGATCTTGGATAGCGTCCGCAAACTCTTCTCGGCGAGTACATGCAATAA
TCACACTCTCGATCAACTCAAACGATCGAATACTgcgccactgccgctgctcaaGCGGCTCCTCTTCCTTTCGAATGTTCCAGGTCGGAATAAGGAGCTC
GTCAGTGTCGAGGCAAAGCGAATAGTCTGCACCTGTAATAATCTCCAAGATACGTGCTGACACAAGATGTCCGTCACGACCTGTGTCTCCGTATCCAGGA
GACATGTATTAGATGCTGTCACCGGCCTGCAACAATTTTCTACCCAGACGTGCTATTGCAGCTCTGACGGCGGGGATGTCATGCGCGTTCATCGTGCTCG
ACGACAAGCTGGAGAGCACTGAGTCGTTTCCTCAAAGACACTCGAATTGCAAGTGTATTCTTGGCTTCTGCTACCAACTTCTGTACCGGAGTGATGGTAC
TGTCTAGTGAGAATAACAGTTTTGTCTAGCGGGATTAACAGTTCCCCTTCAACTCTAGGGCGGCCGTTCGTGGTACTTCCTCCTATTTGAAATAAATGCA
ACTTTCGCCTTTCCACATCGGAGACACTCTATAATTTGATAGTGAACTACTATAGATTTTCCAGAACATAACAAAAAGAAAACGCCGTTTATCTTTATAC
ATCTATAATGACTCCTTCGTGCAATACCGCTACAGCGTATCTAAAAGCTTTCAAGTCGCACTCAAACGCGACAGGAAGGATACTATTTTTTCGAAGCTTG
CTTTTGCTCATATGGGGCAACTTGTAGTCGTTCCCACCACCTGCACGCAGCACACATTCCATTACTTTCTGTAATTTATGGAAAATATTGTCGAGTTTCT
CCGGTTTCAGCGCTAAGTAAGACTTCCGAACTGCACGAATCAGCTCATCGATATTATAGCAGTCTCTTGATACTGTAGGGCCTATATCGACGAAAAGTAC
TCCAGGTCCAACACGTTCAGATCAGGAGAGTTGGCTGGTTGGAACATCAATCAAACGTCCCAACCACCAGCATGACCGGCGTAAAAAATGTCAGGGTCGT
CTGGTAACACATGAGGGGTCGTGTTATCCTGTTGAATAAAAATCGGCTTGTATCGGTCCGCTGGCGACCACTTAGCTTTGATTGACGGGATAACATACTG
tacactcctggtcaaaataaaccggccacccatacttttgttcgtaactcgaCCGCTACTACGAATTACGCGCTCCGCGTTAGATATAGTGTTTCTATTG
TGTAGATTATCTAGCtgtttgtgctaacaacctAAGTTTTGCAG