Description :
From Genome Similarity Track
Location :
Scaffold_53:179668- 228807
Transcript NameFunction/comments
Phypa_INRA-310PPTG_1607260S ribosomal protein L6
Phypa_INRA-310PPTG_16073Ser/Thr protein kinase
Phypa_INRA-310PPTG_16074obg family GTPase CgtA
Phypa_INRA-310PPTG_16075phospholipid-transporting ATPase
Phypa_INRA-310PPTG_16076hypothetical protein
Phypa_INRA-310PPTG_16077myosin-like protein
Phypa_INRA-310PPTG_16078myosin-like protein
Phypa_INRA-310PPTG_16079hypothetical protein
Phypa_INRA-310PPTG_16080hypothetical protein
Phypa_INRA-310PPTG_16081hypothetical protein
Phypa_INRA-310PPTG_16082hypothetical protein
Phypa_INRA-310PPTG_16083hypothetical protein
Phypa_INRA-310PPTG_16084hypothetical protein
Phypa_INRA-310PPTG_16085hypothetical protein

Sequence
49139 bases(100 bases per row)
TGCAAACTTGACACTTCGAGAGGCGCTCTGCCACCCCCTCATTCGTCTGTGATGCTTCCACGTCTCGTGCCTCGCGCCGTTCGGCTTCATCGCACCACCC
TTTTATAAGGAGTCTGGTGTTGGTGTTGCTGCCGTGGGGCATGCGGTTTCCGATGGTTGTATACACGGATAGGTGAGGGGTGTCTTTTTGCCGACGATCC
ATCAGATTATGAGACCTGAGGAATGTCGGATTTAGGGGACAAGGTCACACTATTTTTTATAAGGCTGTTGCTGACTGGTTAAACTACATTATTCAGGCCC
GTACAAGGTCAACGGTGTGCCCCTCCGTCGCGTGAACCAGTCGTATGTGATCGCCACGTCGACCAAGGTGAACGTTGAGGGCCTGGAGCTCCCTGCCATC
GACGACGCCTACTTCGCCAAGGAGAAGGCAGCCAAGAAGAGCAAGGAGGAGCAGTTCTTCGCCCAGTCCAGCGCCGTAAGTTCCCTATTTCATTTTTTGC
TATCCCTTGAAAGCATCCCGTTCCGGTTGGTCGGTTCTTCGAAACCACTACACTCGATCCGCCCACAACCAGCAGCGTAGTGGTGACGCAATGGAGTATC
AAGATCGACGAACCCTATGAGATCTCTCTTGTTCTTCGATTGCTGAACCGCTTCCTGTGTGGCAGATCAGACAGGGAGCTCAATGTCTTTAGACACAGCT
TCCTGTCACACCATATGAGCGCTTGGGATCGCTTGCTTCGGCATATAAGCTCCCTATAAGAGACTGACCGTGTTGCTGTTAATTCTCTAAGGCCCCCGTC
ATCTCGGAGCAGCGCAAGAAGGACCAGAAGGCCGTGGACTCGGCTCTGATCAAGAAGCTCGATGCCGAGCCGTTCCTCAAGGCCTACCTGAACGCTAAGT
TCTCGCTGACCAAGAACGACCGCGCTCACGCCCTCAAGTTCTAAGTGCGCTCTTGCTATCTTGTGTAGTAGCATGGTGTGCAACGGAATGAGATGAAAAG
AACAATATACCTGATGAAATTATCACCAACTTTTAACTTTTCATTCATCCTAGAATTTCGTCAAGTAAATCTTGAAGTAAGATGCTATCGCTTTTAGAGT
CGTCATCGTATTCGCTATTGTTCTCTGATGCGAATTTCCTAGTTGAGTGAACGGTATCACTCTCACTCGCTAGCGCGTTGTAGCTGGAGCTCTTCTTGAT
GGAACCCCCTTTGAAAAGGCCTCCACCATTTTGAATAGGGGGGACAGTTTTCGTATCAGCTACGTCATCATATACACCAGGACGAGAACTGACGAGCGAA
GATCCCCATTCTTGGTGCCGTGAATGAGTCTGCTGTCTCTCCTTGGCAGTCAACAAATGGTGTTCTTGTCGCGATGATAACCCACTTCCAGCCCAATAGC
TTGAAGTCTCAAGGTCATCTGACTTCTTCGCACAGACACTTGATCGTCCTGTATAGCTCGAATAGCCTCCGATAGACTTGCAATCGCCCCGGAGTGGCAA
TACGGGCACTTCTTCCACTGGCATCACTAACGGAGGTATAGTTAATGTAGGTCGTGGCACAGCTTGGTCGAAAAAGCGGTGTTGGAGCGCTTGCGCTGCT
GTAATACGTCGACTAGGGTCGTATTGTAACAGATCTCGTACAAGTTGAACAGCTGAGGAGGGTGTACCTGAAGGCAGAATTCGCTTCCAAGACACTGGAG
TACACTTAGGAAATCGAGCTTGCATGTGAGAGGCCATTGCTGCACCTTCGGGCCACGTTTCCGTAGTAGGTGTGCCAAGAACTTTGCAGATGCGATAGAA
TTGATCCGCTTCGGACGTTCCAGGAAATAACGGGGTACAGATCAGGAGCTCAACTAATATACATCCACAGGCCCACATGTCGATTGGGCTGTTGTATGTC
GTTGAGTGCAGCAATAGCTCTGGTGCTCGGTACCATCGCGTTGCAACATAGTCGGTGAATGGTGGCCGTGATCGGATCTCACGAGCTTGACCCAAGTCTG
CGATTTTAAGTGTATCATCGTGACACAACAGGTTTTCTGGCTTAATGTCGCGGTGGAAGAAGCCGTGCTTGTGCATGTATGCAAGACCACTGAAAAGCTG
GAACATAATCGATCGTATCTGCGCCTCCGAGAACCAGGGATGCGGCGGTGAGGATGAAGTGGACGTGTCGGAACTCGAGCTTGTATCGCCACCAAAACCG
CTGTAGCTGTTGGCACTGACTTGACTTTTAAAGTTACGCATAACTCGGAAAAGCGACGTCTGCAGGTACTCGAATACGAAGTAAAGCTCTTCTTTGTCTC
GAATAACCTCTTTCAGCAACACAATGTTATCATGGCGCAGTATTCGAAGCGACTTGAGCTCACGCAATTGGAGGCACTCCTCCCAAGTGGGAAATATCGC
CTTGATCTTCTTCACAGCCACAATTTCCTTCGTCTTAAGACTCCGAGCACGCGAAACTTCACCGAACGCGCCATCACCGAGTTTGTCCAGTATCTCATAA
CGATTCATCTTCTGCTACGTGAATTGTAGACTCCTCGACTTGACTGATGAGGCTTATTTTTTAATTTGCTGGGTTATTTTTACAACCAAGCCACAAACAA
CATAACACAAGGTGACGTCAACACTAGCAAGAACCCCTTGTTGCTGAGTATATATGGTCTACGTCGCCTATTATGTGGTCTATGACGCCTTGGTAAGCTT
GCTATAGCTCTCAATCATCCATCGGAGTGTGCGTGCTATCGTATCAATGTCGACCTTGTGGAGTGCACTATTATAGAATCACACCTGGTTAGGAAGTGTT
GTGAACAACAAAGACTTTCAGCGCTTACCTGACTGGAAGCACAGCAAGATCAGTGGACTGGCGCAGCTTGTGAAAGCTGTCTTCGGCGCCTGTGAAAATA
CCAAAACGTATTGTTAAGATACCCGACAGCACTGGATGACGACATCATCGCAGAGATAATATCTATACGGGTGCAAGTCGTACCTTGCTCATCCATCTTG
TTGGCAACGATGAGGGAAGGACGTGACGAGATTCCTGGGGCATACAGCTCCAGTTCCCTTTGGAGATGGGTAAAGTCCTCCAGGGGATCACGTCCCTCTG
AGCCCGCGGTATCAAGGACGTACATCAAGATCTATATTGCCATCGTCACGCAAATTGGTTATCGAGTATCCAGTTCAGCATGCCGGACAATTTCCATACC
TTTGTGCGCTCAATGTGACGCAAGAAGTCGTGACCAAGACCGACATTGCGGTGCGCACCGTCGATAAGTCCGGGAATGTCAGCCACACTCAGCCGGAAAG
TGTCTGGGAATTCCACAATGCCCACGTACGGGTGAAGCGTCGTGAACGGGTACGGCGCGATCTCAGGCGTGGCGCGGCTCAGCACACTCAGCAAGGTAGA
CTTGCCAGCGTTGGGATATCCAACCAAACCAACATCGGCAATTGTCTTGAGCTCCAACTCGTAATACTGCGACGTACCCGGCGAGCCCGTAGTTTTGCTC
TCAGGCATGTGCTTGCGCAGCCGACCGAACTTGGTCGTCTTTCCAGCCAGGATGCGGTTGCCCAGTCCAGGTTTACCGCCCTTAGCAGCGAGGAAGGTAG
CACCAGGTTTGTCCAAGTCAGCGACAACTTCCATCCTATCTACAATCTCATACTCGCCGTCCTCGAGCTCGCGCTCGTAGCGCTCCACACGCTTGACGAG
TGTGCCACACGGCACCTTCACGTGGCAATGCTTGCCCCTCCTACCCGCGGAATCGTTTGCTGCAGCCACACAACAAATACCAACATAACAGTCAGCCTCA
CTAAAAGAATTGCACTCAACCACAAATCATTGCAGGACGTACGCATGCCGTTGGTGCCTGCTCCGCCCTTGAAGTGGTGCGTGGCGTTTGCCAGATTCTG
CATCTTATCACTGGCTTCGATCACCACGTCGCCTCCAGCGCCGCCGTGTCCACCATTGGGACGTTTGCGCATGGCTGACTCGGAGAAGAAGCTCGCGCAG
CCGTTGCCACCGTGACCTCCCGTTGCCTTGACGCGGATGCGGTCCACGAAGCGGCGCTTCGAGTGCTTCGCACGCCGAATGCTCACCTTCTGCTTCACGT
GTTCCTCCACTTTACGGCGACCGGCAGACGCTACATCGCCATCGTCGTCCAGCGTCCAGTCATCCAGCTCGAGGTCGTCCATGTCGTCCCAGTCCAGCTC
CAGGTCCTCCAGTTCCAGGTCACGGTCATCATCTTCATCGTCACCGCCTTGAGCGCTGAATGCACGCACCGACGAGCGATTGAAGATGGTGCGGCGACGC
ACCGGTGCAGCGGTTAAGCCTCGGAGCAGGTTGGACACGCGCAGCATGGTTGACGTCTTCGAGCTTGGTAGCGGTCCAGCACTTCGATGGTTGCCTTGGT
ACTGTAGCTAGTTTCAAAAGCACTTCGAAGTATACACACACCACATCATTTTCCAAAATTGCGCATCTCTCTCTGGACTATTTGGGGACCCGCATCTTGG
TTTCAGTATGCTTCTTTTATAAAATTCCACGCTCGGTTTGTGATGCGTTACTTTGCGATCAACCTAAAGTAGCGCAAAGTAACGCTTAATTGCGCAGCGT
AAAAACACTATTTTTGTTAAATCAAACGTAAAACACTTTTAAAAATGTATTTTAAATATTTTTACATTTGTTTTTAAACTAAAAATGGTGAAACAAAATC
AAATTACAATAACTGGCTAATAATAAAATCAACCAATTATTGTAATTCGCCATTCAAAAAAGGTGAAACGGCAAGGTTTATTTGGAACCCATCTCAAAAT
AGTCAAATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACATAGTTCCAAAATCTCGTCGTGACGTATGTTGATTGGCTCG
GGGATGGCATTCAGACGAAAAAAACCCATTAAAATTTTAATGGCTTTTTTTCGTCTGAATGCCATCCAAGCCTATATTATTACGACCCAACATGTTTTTT
TTTTGAGTTGGATCCGAATAACCCAAATAAACCGTACCGTTGGATGTCATTCAGACGAAAAAAAAAACCATTTAAATATTAATGGTTTTTTTTTTTTTCA
AAGTTCGTTCGAGTGCTGCCAAAGAGTGAGTGTCATCGAGGACAGCAAGGGCGAACGCTCGACAAATGTTGTCAACACGCAAGGGCTGCGAAAATCAGCC
GGATATCCGCCGATGACTTCAACCGCCTCTATGACAGGCTGGTTGTGCGGCGCACCAGCAAAAATAAGCGTGCGAGGAGGCAAGTGACCACTGTAGTGTC
GGTTAATTCAGCTGAAGATGCCAAGGCGTTGCAACAAGCATCCGAAGCTGCGAGACTGGAAAAGACCAGGCACCAAGAGCAACTGGAATGCGACGCAAAA
ATCGCTAGCACAGTGAAACGACTTCGCTTCGCTAGGAACCTGCGCGGCCTCGCGCGGTTGACGCACTGTAATCCTCATCAGCTCGCTTTCCAACTCGTAG
ACGCGACTGAAGAGGAACAGCGTCAGATCCTATTAGTCGTGAAGTAGTAAAAGGCTCAGAGACGACGGCATGAAGAACGCACTTCGGAGGTGGAGCGGAG
CATGATACTGGAAAGAATTGTTGCCAGGTGTGTTTCATTCTGTGCTGCAGCTACCACACTGTTGAATTGTATGTTGATGTGTGAACTGTGATGTACATGT
AGGTTATTTCTTCGTCGCGCTGTTGGCTTTCGTCCTGACGCAGCTACAACACTAGAGGGAAAACCCCGCTTGATTGATGAACTGTTGTTCTTCTCGTATC
CAAACCCCGACATTGTTATCCAGAATCGGGTACGCGGAGATAGGAAATGTTGTACCTACTCCACAAATAAAACTCGCGACCAAGGGAACAGTTGAAGACA
TGGTACATAATTTAATGTATTTGTGAAAATTCAACTAGGGCCTAACCTTGGACTCACCCAGTCATGTTGTACTCGTGATAGAGCTTCGACTCATGAGTAA
CCGAGTCTCTGTTGCCCCAGCGTATCCGTCTTTGGAGAAGGCAAAACCATGATATCCCTTCTGTAGTGTCGTCCTGTGCTGCTGGGTTCGGCCGTTGGTT
GGAATGATGGAGCCACTTTTCTTGGCGGCCCTTTTCGTATGGGGAAGCCGAGCCGGTACTGCCACTGACGCGTTACTATTGTCATTCCATTGCAAAAGTT
TGCGGTCAAGGTTGAATTTTGTGACCTCCTTCGCGAGATGCCAGTACTCCGGGAAGAACGTCGATTTGATGCCGTTAAGTAAATGTGCATACGAGAGTGC
AGCCACCGGAACAAACAGATAAATTAACCAGAACGATGGAAGCACAAACGCTTGTTCCAGCATGAATTCCCACGTGAGATCCGAGAGGAAGTAAATGTGA
CTGCATACCAAGGCGACCAGGAGCCACATCAACACTGATCCAATGTAGAGAACGTAGTTGAAGAAATGGAAACTATTCTGGAACATGAACAACTTCGAGT
TGGCGATAGATACAACAAGGGTGAAGACCAGGAAGCCTTCCAACCACATCGTCGGGCTTGCACCAGCATAACCCGCGCTTTGCAAGCTGTGAAGCGTGAT
GAACGTGATGATGACACTTTCCACAATTGCACCCACGACCCATAGCGTAAAAACACGAGTGTTGATGTCTTCATCACGAGGTCCTGTAAAATAAAGTTTT
GGAAACGTCATGGCCACATCATCGCTGACATCTTGATCCAAGATCGAGAGTGCAACGATAGGGATCGCAGTAAGACAAATGTTGTACAGCTGGGTACCGC
TCTCCAGGAAGAACTTCTGCCCGGAGAATCCACACAAAAGAGTGTACCAGTACTGAGCTGCGGTGAAGAGAATGTTCTTATAAAAAATGTACAGCACCAG
CTGAGCCATGCGTCGGTAGTTCCAGCGACCGTGTACAAGCAGCAGACGCTGTAAAAAGCGAAACTGTGCAATTGCGTAGTCACTCGAGTTCACTGCCTGC
ATACCTTCCTGACCTGAAATACCGACACCAATGTGGGCTTCTTGGATCATTGATACGTCGTTGGCTCCATCTCCGATAGCGAGAGTTCGAACACCAGGTA
CATATTCCTTGATCAGAGCAACCATTTCAGCTTTCTGAGCTGGTGACACTCGGCACGCGATAACAGCTTTGCAGTACTGAGAGAACTCGGCCAAAAGTGG
ACGACATGATCCACGGAGAGCGTACATGAGAGTCTCACCATCAATGACTAGAGCCAACTCCCGCAGTTCACCTCTGGTACTCGGCGGTGAAGCAAAGTAG
ACCGTGACATCACCACTACGAACTCCAATTTCATCTCTCAGAGTGCTTTCGAGTATCTCTGCGGTCGGCGCATTCTTTGAATTGATGATAAAGAGCTTCA
TATCGTTGGTAACAAGTTGACAAGCAAAGCCGATGTTGATGGCAGTCTCCTCTTTGTCGCCTGTGAGCACCCAAATTTTGATTCCAGCAGACGCTAAATT
GGCGATCGTGTCAGGGACTCCTGATTGCAGCTTGTCTTCGATAGCAGTCGCTCCTAGCAGCTCCAAGTCGCACTCGATCTCATTCATACAAGCGTCAATC
TCGTTCGGGAGGTCCTTTTTGCGCTTGTCGATTTCATTTAGGTTGTTTTGGGCGTCATGGAAGCGTGTTGCCCACTCCGCATAATATGAAGGATCAATTT
CACGAACAGCAATCGTAAGTGTGCGAAGTCCATCTTCAGCGTACTGGTCGATATGCCGCCGGGTGATCTCCTGAAGCTGAGAAGAAGTCGATTCTTCCTC
ATTGTCCTTCTCGAGAAGGCCATAAATGATCACATCAGCGCCTTTCGAGTACAAAAAGATCCGGCCGTTCGGGTGGCGAATAATGGTGCTCATGCGCTTT
CGAGTGCTGTTGAATTCCAGCACGTCCAGCATCTCGTATTTTTGAACAGTTCCGTGGACTTTGACATGAGCTACACCAGGAGATCGATTCACAAATTCGT
ATCCAAAGAAGCCTGCACCTGCAACCAGAGCTTGCTCATCAGGAGAAGAAGCCGAAAGCGTGATTTCTGACGAATTCTCATGACGTTCCGGAATGACGGT
ATGGCACACCGCCAGGTGCGTGAAGAACGCATCGATGCGTCCTTGCTGAACTGATCCCGAGTTGCCTTTCATATCGTTAAACAACTCTGGACCGTCGAAG
TTCACATACGGCACCTTGGGTCCTTTTGATTGAGTAGTCATGTCTGGAAGAGGTTTGCCAGCACGTCGGAGAGCTGCTAACCCAATTTCCGTAGTTCCGT
TGCCGTAGGAAACGCCACCAATTGAACATTTTCGGAATTCCATAACGTTGCAAGTGAGAGTACCAGTTTTATCCGAGAAAATGTACGAAATCTGCCCAAG
CTCCTCATTTAGCGACATAGAGCGAACTAGTGTCGGCGTGTCCGTGTCAGGATGGTAAATGTTGATGTCCCATTGGATAAACTGAGCTTGGAGATATTTA
ACCATACTCATGGAGACAGCTAGCGAAATGGGAACAAACTGGTACATGAGTAACAAGTAGTAGAACCACATGATGATCCAGTCCACGACGACGCTGTTTT
CTGACGCGGTCAGCTGGAGGTACCACAAGGAGTCATGGTTTGTCTTCCATGTCACCGCTCCTGTAGCACCAACCGCACTGAAGATGACCAAAATCGCCAG
CAACACGACCGTGTACTGGTTAATAGACCGGTCCATTGAGCTCATTTTTGATGGAGGGGCAGAGTTACTCATCATGATCTTCGTATCCTTGCCGGTGTTG
AAGACCACACCGTGCACCCAGTCGGTGTTGCGAATGATACATCCACGTAGGATAATACTTTCATACGGAATGGAAGCCTTTTCCTTTCCCTCGAGCTCGA
GTACACCTTGAAAACTGTTGATGGCATTGTTCGGGTGCTCACACCGAATGGCACCTTTCATTCTTAGCAAATTGTCAACTGAGCCCATGTCTGCAAGTGT
GCATTCCATGGCAGATCGGACTTTCATATTGGTTTCTCCATCCAACGACTTCGTTTCAACGTAGCAAATACCACACGGTGACTGGTTCGGAATTTCACTC
ACCGCCAGCACGAGCATGTCGGCCGGTACCAGTCCACGGTTGGTAACTTTGATAATGTCGCCAACCACGACGTCAGCCCACGTGACCTCTTTAAATGTAT
TAGTTTCGCGATCAAGCACGAGGGTTGGACTTGCATTGGCAATATTGTCGGCTTGATGACGCTTGTGGTCTTCGAGTATAGCGAACACGGCATCAACCGT
GATGATGAAAACTAGTGGAGGTAACGTCGAAGGATTTCCATTCGTGTTACTGATCTCAGGGATGCATTGCAGGATGCAGATGACGAGGAAGTAGAGATTG
GAGAGTTTACGAAAGCTCTCAAATAGGAACTTTGGTAAGAAACTCGCGATGGTGTATTTGGACGTAACGATGAAGTTATTGCAGTAGCCGGCTTCGATGT
TGCGGTGTGCGTCATTAAGATAGACCACACGGAAGTCCCCGGCATGCCCTGCCGTTCCTTCACCCATGGCACAGCCACAACCAGAGAGACAAGCAGGAAA
TAAGGAGGAAGAGCCGAGTGCTGCTGCGATCGGCAGAGTGAGGTCGCACGATGCAAAATAACGGTCCACCACTTTGAATAGACCAGGACGAGCACGGTGC
GATGTGAAGCAAGGAGTTTCGCGACAAGAAAACCAACTATTTTTACGGTGGAGCGTCTAGCTAAAAGCGATGGAGTTGCTGTCCGTCGACTTCATGGCTG
TAATGGTTCTCGAAGCAACTTGTACAGTACAACAACTAGCGCTTTTGTTATTAATACTACCCAGTATCTAAAGCGACAGGGGTCTGTTCTCACCTCTCCG
TTGTTGAAATGATTTGCATACAAAGTTTGTGCCGAAGTTGCCTTTCACTTAACTTGTCGAACTCAACAAGGTGCAGAATGATGGTCTGCTTCAAGTGCGG
ATATCTTCTTTCCGTCTCACTTTCGAATTTGCCAGCCCAGATACACGTCGATGAAGACACAGCGCACTCACCGGCGCAAACTGAGCTTCGCCTCCTCGAA
AGATGCCGCCCCGGTAGCGACCGTCAAGGTCGAGTGTGCCCCCGAGCGGCCTATAAAGCGACGCAAGCGCCAGTCATACCGTCGTTTTGTCAGTCCGGTG
CCGATACGACTCGAAAACAGCCTCCCTGCAGCCATGTGGGGCAACATTCAAGAGCAATTCGCAGCAGCCAAGAGCCTGGGGGACATGTACGTCTAACGAT
ACTGCCGTAGAAGGAGATACAGCTGACGTGGAGCCGTGATGCCAACCAGAACGCGCATTGTGTTGCAGTTCTTCACAGCGCACGAGAGCCTCCAGGGCTC
TTCGACCGGACCTGTGTTTCCCATCTTCGTTCCGTCCAGTGGGATCTACAAGATGAAGGGTAGGACGTGCACATTTCGTCCTGGTGATATTTGACCTGAT
GATCGCTACGTAGTGCCGAGAAAGAGACGCATCTACGACGTACTGCACGTGCTGGAAGGTATAGTTTCTGTGGGTTTCTAGGAAGAGGAACGAGGGTATG
AGAACGTTTACGACTACAGGGATTGGAGTCATCAAGCGGGTTCGCTACGACGATAGACGCCGGACAAACGGAGGCTACTTCTTGTACTATGGGAAAGCTG
CGGTGGTGCAATATCTGGCGGAGATGAAGAGCAACTCGGCTCAAGTGATGGCAAACTTCCGAAAATCTCGTCGATCTAAGCGGACCAGCATTGTGGAAGA
AGACAGTGCTCTTATGAGAGTTTTCGAGGACCAGGCGGCAGCTGGCAAGTGGCCGTGCTTGGTGAATATGACAGTCTGCTTCCTGGGCTTGCTGTTTCAG
CAAGACTGTCAATATGAGGTGGGATTACCCACCTTAAGTGCCCGTCTCGGTGAAGCAAAGAAGTTTATTGGTACTTTGCTGTCGAACTCGTCCACAGAGG
CTCCTTACCGTGACGTGCACCGCCGGGTGTACGATGTGGTGTCCGTGCTGGTGAGCTGCAATATGATATCGACGTCATCCGCACCTTCTTCCGAGCCTAT
GGACAAAGGTTTGCGAAAGTTCATCCGATTCAACTACGACATTTTCACGGACCCACGGATCCTGTTTGCCGCATCTGACTCCGTGGAGCAGTGGGTCGGC
GAGACGAGCGATGAATCGATGTTTGGTGATATGGTGACCAGCTTGTGTGACCTTAAGAGCCCGAAGCCGGAGGTTCTAGATGACCGCATGGCTTCTACTC
CGCTGACTTACTGGCAAAGTCTGCACAAAGGAACATCTTTGACTGGCTCGACAGTATTTTCACCGGTGACCATTCTACAGTCCGAACTGCTTCCGTACAA
CGAAGGCAAGGAAGTGGGTTTACAGCGCGGCTCAAGCTCACCGGGAACCGTCGCGAGATGTCGACCAGAGGAAGCAGCACGTGTTCAAGATTTCTTTTCT
CCTCTGGGAAGGTTGCCGAAAGAGAACAATGACTGGTGTGTCGAGTCACTGAAGCAACTCGGACTGTACGATGCTCTTCCTGCCGATGACAAAATCGATT
GGGAGCTGAACAAGCAGTTGAAGGAAAACTATCGTGAGATGTGGGGCTGCCAGTACCCAGGAACAGCTTCAGTCGAGTTGCAACCGGTTGACAGAATGAA
GGTGAGGGTGGTAGATCTCGAGTGCTATGAAGTACTGGATGGTGACGTAATTGGGAACACCGCCAATTTCTTTTGCTGATCACGCCGCTGTGGTCGGAGC
TTGATTTTGGCGACTGCGTAACTTCACAACACACTTTTGCAAGTCGGTTATATTGTTTGCACTGCGTTCACTTGCAACTGCATCGCTACAGCACTCCACA
AATGAAGTTGGATTAAGCAAAACTCGACCGTCGAACTGCCAAGAGGATTCAGACTCCCAGCCAACGCTTTTTGATTGTGTCGTGGCCCACGTTAACCTTG
GTAACATCAGCTTCCGAATCAAGCGAGATTACAGTGGTCTCAGGTCCGAATCTCGTCCTAGGAACCGTAACGAGTTGCAACGGTGTCGACCAAGTCGGTG
CAACATGTTCAGTCCGCAGATTGCAGTTTTCTTTTTCATGAACCACTTTGCTGCGCTCAGTTACAGGCGCGCCGGTTTTCGAGCTGATACTGGCCATGCC
AGCGCATGGCATGGCATGGCAGTATCTGCAAACTTTGTGATTAAGGGATAACGAAGACTTCAGATTGCTCTGCACCATAGACTATGGTCCATAGTCAGTT
AGTCAGTTGCTTAGTCTAGCGCCGCCAACCGTCTCACGCTCTCTTCTCAAGGTGAACTTGGCCGTTATTTCTGGTCGCTGGGAGGTAGCTGCACTAGCGC
CGCGCTGCTGCTGGAGATCGCATTGCGCGGCATGTATCTGCTCCTTGATCAGATCCAGTTGCGCTTGGGTGGCCCTCTGTTCTACTCGCTCTGTTCTCTA
GCTGATCTCGGAGCTCGATGTTTTCGGCTTGTGCTGGCTCTAGCTGATGCTTCACGGTGGAGAACTCGATTAGCAAGTGGCGAACCATTAGGTTTGAACG
TTTTGGTGCGTTGGTCCAAGTCAGTGTTGTAGCTCACTTCCTTCAACGGGCATCAACTCCAATAATGTCAACAAATAATGTTACTGTATCACTTCAACTT
GGACGATAAAAAAGGCAACAGAATTACATGCAAGTAAAAAAATGCTTTGCTTCTACGAGTATTGACTTAACGCTGTTGCCAATTTATTGGAGAGCTGGAC
TCACTGCTCATGAGGACCGTAAACGTGCTGACGTAGCTTGGCGCTTGTTCTCATCGCATCATTCCGTAGGTAGCGCTTATAAATCCTTGCAGAGACTTTA
TCGTACTTCATCCAGTACCCACAGGTCAAAAATCGCTTGGTTTTGATGCCCGGACGCGAGAATCGAACGGTCGCCTTTGGTGGCCTGCGAATAACTTATT
TCGGTACGACTCGAGCATTCTGCACCAAGCCACATCTCGAGCCTTTCATAGGGAGACTCCATTCTCTTTTCTAGGAAATACATATCAAGCTCTGTGCCCT
TGAGTAAATGCGTGTGTGTCCCGTTTCTCTTTTCCTGGCAAGCAGCTTCACACCTGCGACTCCCGCGGCTTGCTCCCACTCGCAAGTGCCTCACCGTGTG
AGGCCCACGGTCTTGTACACAACCACACTCCGGTGATACGATGGTGCGTGTCGTGTCCAAGCTGGTGTATATGGGATGTTTCAGGAGTGTAGTGCGCCAA
ACAGGGTGTAGGCAACAATCAGCGAGAGCACGGAGCAGCACTTCCTACTTAAATGGACGCACTGCATGCAAATAAATGCATCGATAAAGTCTCATCCACG
TTAATGCTGACAAAGTTTTTGCGGCTTATAGATGAAGCAAAGACAACTGTCGACGGAACTTCATTCTCGTTTTCTACGAGTTGACTTTTATATGTTCGGC
GGGGTTAATATACCGGAACTTTTAAATCCATAAGCCGCTGCTGCTCAACGGAATATCCGTGACACCAGAGCAACTCAAGAAGCCACTCGAAACACTATCA
CCATCGTCATCTTCCCAGTCATCCTCCTCCCAGTTCTCTTCCTCCTCCTTCTCACTATCGCTATCATCTTCATCTTCCGTGTCCAAGCCGCTGGCTCTTC
GTACGATTTTCACAGCCTGCTTCTCTGCGGCATGGGATTCCAGAATCAACGACTCGGCACGATTGCGTGCTAATGCCGCTGCAAGCTGACTCGCAACGAA
CGCCGGCACATCGTTTGCATCCAGAGTCAACGTTTCCAAATGAAAGTTGACGTCCAAAGCGTCTAGTAGTGCCTGGGCTCCCACCTTCGTGACCCGGTTG
TGAATCAGTTCCAGAGATTTGAGTGCGCAGTTGCAACGAATGGCCTGAGCGAGCGCTGTAGCGCCACGATCCGTTATCAAGTTGCTTCTCAAACACAGAC
GCCTCAACGAGTCGTGTCCGTACAGTGCTTGTGCCAATGCTTCAGCTCCTCGATCACCGATGTTGTTGCCGTACAGATCCAGATACTCCAGAGTCGTGTT
GTTACACAGCATTTTCGAGAGAGCGACAGCTCCATCGTCTCCGATAGCATGATCCCGGATAATAAGCTTCCGAACAGTGTGGTTGGTCGACAGAGAGCGT
GCCACAAGAGCGCATCCTTCAGCTTGTAGCCGTTTATTGCGCTTCGCGAGGGTGGAGAAGTCCAGCTCGCTGACATCACCATCGTTGAGATGGATTCGCT
GCAAGATCGAGCCCAGCGTCGGGCCTGTGCGCAAGACATAAACAGCATAATGAGTCAACACCTTTATCACAATCAACAAAGGGATAGCCTCCACTGACCT
TGCACCCGTGAAATGTACTTGGACTGCGGCATCTTCTCCGGCGAATAACTTGATCGATTTTCTTTGCTCACACGACGGGATAGTGGTGGCTTGCCAACAC
AATTGGTCTTACTTTCAGAGGATGATACGCTGAATATGGAGCTCACGGACGATGATGTTCCAGTTGTGCTTGTTGACGACGGAGCTTGCTCCGCTTCCGA
CTTCTGGAATTCGTCAACGCTTTCTGAGCTAGCAGATTGATTGCACTCTGGGTTATCGTCTGCACTTGCATCGTTGACAGTGGGTACTGGATTCAACTCG
TGCTCGTGCTGGTCCTCATTCTTCTCTTTGCCGTCGCCAGCAGCTTCGGTCTCCGTCTCCTGGTTGCAACTCTCGCTTTGCGCCACCGATAAAGATCCAC
AATCAGCGCTGCTGCGCTTGTCATCACAGCCACGATCAATCTCCTTGACGGTAGCACCGGGGTCCTCCATTTCCGGGTCAAGCTCTAGATTTTGAATCCG
TGGTGCGACCTCGACGGAACTGGCGGGATTCCCATTCTCTGGCTGTGCATCGTGGCTGACTTTAGCCTGAGCAACGGACTTGGATCGAAATATCAAGCGC
CTGGGTCGGTCTCCCAGCAATTGGCGCCAATAGCGCTACGGTCGACAATTTAAAAAAAGCACCGGTCAACGTCACGCAGGACAAGAATAAGATGCTAAAG
TCCAAAACTCAGATGAAAACCGAGAATACAAACCTCGAGGTGGACCTTGGCACGACGGAGATTGATGTCGGGCATCAGTAATGCCATCTACGCCGACTTA
TCGGCAGTGCTGCTTGCTCCTGACCACTCCGTTTCGAAAAACTCGAACCTTCGCTCTCTAACAAGGCAAAGCACGCACGGAACTCCGATGGGGATGCTGG
CTGAAACCACACAAAGCCTTCATGTCCCCAGTAACTCACAAGAGAGAGAAACGGCTTCCATCTGTATGATGGACAGCACTGCGCATCAGCGTGAGCACAG
CCCGAATGTCCTCTCCCGCGGTAGTTGAGAAGGAATATGACAGAGATGTCAAGACGAAAACAAGATGCAACAACAAAAGTAAAACTACTCAACGTCTTCA
CATGTTGAAAGAGAAAACTGTTCTGGTCTTTCGATACAGATATACGCCTTGGGGGCGTTTACTTAAAACTGTTCTTGTCACCTGGCTGCGGCCTTGACTT
TATGCTCAACTCGCAGCGAGGGATACATGTCGTCACGCCATTTTTACCTCTTGCGGCTCTTGTTGATCTCGAGAATGATGGCTTGCAACTCGATGCACTG
CTCACGCATCAGTTCCAGATCGTATTTCAGGTTGCGGTTCTCGATCTTAAGCATCGAGTTCTCATCCTCCAACGAGATGCCGCTCGAGCTCGAAGTACTG
CCACTACCGCTACGCGGCTTCATGAAACTCTTGGCACGCGCCGACAGTTCATTCAGACGCTTCACGCTGCCACGACGACCGGAGTGAGCCACCTTGAACG
ACTCCATCCTGTCCGCAATTGACCGGCCGCGTCCAGCACGGATCGAAGCCGGATCGTCGCCAAAGCCCTCGTCGGCATCCGAGTCGTCAATGTCGTCAAT
CTCATCCACCCACTGACCACCGTTGTTGTAGTCCTCGTATTCAGGCTCAACGGGGATAGATTTGTACCTCTTCCAACCACGCTGAATCTTGATGATCGCA
CGACGCTGGAAGTGATACTCCTTAAAGTCCAATGACATGCGAGCATATGACTGCAGTACAATAGCAGCACGGATCTTGTTGCGCAGACGGCGACGTTCCA
AGAAGCCCAAGACGATACGCTGAATAGTACGTGCTTCGTAGTACATGAAGTCGGACTTCATGGCCTCCAGCTCTTCCATGACACCGTTCTTGAAGTAGAT
CAGCGTCTTACCCATCTGGTATTCCAGCGGGGATTTCCGACCGATCGATGTCATGAAAACGCTGCACGTACGACGGACATCCTTGCTGTGCATGGACGGC
GGGAACATGATGGCGTATCGCGTAGCGAGTTCCTTCGGGGTTAGACGACTTGGGTAACCAGAGCGAGTAATACGAATGGCTTCGATCACACCGGCCGATC
GCAACTGCTCCACGATCATGCGCTTGTTGAACTCCGTCGGACTCTTGTTCGGGTTGGGCTTAATGCAACGCACGTAGTGAGTGTTGGTGGTCTTGATGTT
GTCCATCAATTGCGCCAGCGACGTCTTGAACTGCGAGCCTAGACTCTTCGGGGCCTTCTTGCCACGTCCACTGCCACCTTCCGTGGTCGCCTCAGCGTCT
TCGAAAAGCTCCGGAAGCAGCGAAAGACTGCTGAGCTGGATCAAGTCAAGCAGATCCTTCTGCAATGTATCGCGGTGTTTCTCCATGAATCCCACCGTCT
CGTACGTGACGGAACCAGCGTAGTGGTTGATGATGAACTGCGTACGCTTCACCTTGGGAAAGTCAATACTCTCGTTCACACCGCCACCCTTCTTCGTCTG
ATGGTTCGTGCGGATCTTGTTGACCAGAGCCTCTTCTGTGTCACGGGGCTGACGAAGGTGGTCGTTCATTAATGCAATGATACCCATCTTACCTTCGATC
ACCTCCACGATACCTTGGTTGTCCTGGTACTGGATGTGATCCCACTGCAAACCTTCACGGATGTACTCGTCCTCCACAGTCTTGAAGACGTCAGTAGTGA
ATTTCTGCTGCAGCTTCTCATTCGCGTAGTTAATACAGAACTGCTCGAAGCCATTGTGAACAAAGTCCTCAAAACCAAAGATATCCAGCACACCAATCTG
GCCCTTGATGCGGCTCTCGTCCGTGCTGATAGCAGCGTTGATCTTTACCACCATCCAGTCGAACATCTTCGAGTAAATAGTCTTAGCCAACGCGTCACGG
TTCTCCGCTGCTTCCACAGGAGCCAGCGGCACCGTCACACTGTCGTTGCGAGTAATGACCGTGCGGTTGCACAGTGCTTCCTCGATTCTCGTGGTGGGAA
GACCAAACATCTTGGCAACCTGTGACAGCGCCGAACCACTAGAAATGCGCGACCCGTTCTCCCCACTCTTGTCGAACATGACCTCACCCAGCAGCAGTAC
ACCAGCCAGGATCTTGAACAGCGTCTTTTGCGCCTTGTCGTCCAGTCCAATGATGGACAGCGACTTCTGCGTGCCTGCAAACCACTTCGCGTCGTCCAGA
CCAGGGATCTGCATTTCCGCGAGGGAACCAGCGTATTGGTATTGGCATTCAGGGTCCAGACCAAACTCCTTGCGCTCACGGCTAGGCAGACCCGCCAAAA
GCTGGTAGAAAATGTGGTAGTTGCGCTCACCCTCGGCGATCGACACCACACGCGACTTCTCCAGCAAGTACGTCTCGCACTTGGCACCGATGAGTTTTCC
TCGGCCGTCGAACTGCAGCTGCGTGAACTTACCGAACCGCGAACTGTTGTCATTCCGTGTCGTCTTGGCATTACCGAAAGATTCGAGAAGCGGGTTCACG
TCAATAACCTTCGCGATAGTCTTGTCCTTGCGGCCACCAGCCACACTGGCCAAGTGGTTCATGACAATCTTGGTCGTTTCAGTCTTACCGGCACCAGACT
CACCACTGACCAGGATACTCTGGTTCATTTCGTTAGTCTTCATGTGCTTGTAGGCAGCTGTAGACGTCGAGTACACGTGCGGAGGCAGCGAGTCACGTGG
CTTCTTCAAGTACTGCTCGTGAAGATGATCACCATAGAGGTTATCAATCCACTTGTACGGGTTGACAGCGATCACAATGTCGTTGGTGTACGTGTAGGGC
TTGGAGGCGGCGAAACGCTGCTTCAAGTTGAACAGAATTGAAGGCTCGTTTAAGTATCGTAGCAAACGCATATCCTCCACGCCCTCCGGGTTATCGTGGA
GAATAGCAACGGGTAGCGACTCCACTTCGGTGGCTGTCGGTCCAGCAACTGCGCGAATGACGTCTGGGTTCTTGAGATCCACAACACGCTGCTCCGAGTC
TCCTGAGTCCAAGAACGCTGTGATCGTCACTTCTTTTCGGCGATCGTTGTAGTCCACAATCTCGGAGAGTAGCCACACTTCCTCCTTGTCAGGAATATAG
CACTGCACACCTGGCACGATCAGATTCTGCTTGTTGCTGGCACCTGCAGCCTGTTGACGGAGCTGTTCCTCCTTAATTTCTAGCTGCTCGTGCATGAACG
CCTTGCGCTTCTTCTCCAAGCTGAAATTGTTGCGTCGACGCTTAGGAGGCACCCAGTACGTCTGACGCTTACGAACGTAGTTGCCGCGACCTGTGGAACG
CTCAATCATGTGGCGCGGCTTGAACGGTGTCGGGGCTGCAGGAGTAGGTGCATTAAATGCTGTCTTGGAAGCTGATCGGCCACCAGCCGGAGCGTTCTTC
AACGGGTTAAAGGCACCAAACGCCGGCTTTGGCGGCGCAGCCGCAGATGTTGTCGCAATTGACGGCACCGAGTTCGTTGACGCCAGGAAAGCAGCCAGCT
TGCTCTGTGATCGGGGTTTCGTCGAGGAAGCAGGTGACGCGGACGGTTGCTGCTTCATGAAGTCGTTAAGCTTGTTGCCACCTCCAGTGTTGACGGTTGG
CTTCGAGGGAGCAGGGGCAGACTTGTCAGGCTTCGGACTACTGTTGCCCTGAGTGAAGACAGCCTTGCGCTGCGCGAACTGGTCGCTTGACGTGCCACGT
CCTCGGACAGGAGCAGACTTGGGTGGGGAAGGTGGCTTATTACCTGCAGACCCGGTGTACGGGCCCGTCGTCTCGACAGCAGGCGGGTTGGACTTCATGA
AGGCTGCGAACTTGTTACGGGCGTCACCGCCAGTCGGTTGGGACTTGGGGGGCTGCTTGGGCGACGCTGGTCTCCTCACAGTCGGCTGGGGCTTTGGTGC
CGGCGGCTTCCTCGCGGCATTGGCCTTCTTGGGCGGACCTGATGGACGCTCAACGTGCGTCAACGGGGAGCCGTGTGACGCCGGCACTTGGTTCAAGAAG
GCGTTCAAACGGTTGGCATTGGCACCTCCGCTGTTGCTCCTTGTGTCCTTCGGAGGTGGCTCCACAGGCGTCGAAGGCGGGGAGTTTGAAGGAGACACTA
TTCCCGCTCCAACTTGCGGTGACATTGGTGGAGGCGTCGAAGGGGGCGTTCTCTCGGGGGATTTGTCCACCACCTTCTTGCTCGACTTCTTTTTTCTTGA
TAAAAACCCGCCTTTCATGAAATTCGTGAGTTTGTTGTTACTGTTCGTCTTCTTGACAGGTGACGTGCCCTGCGAGCTGCCTGTGGACGTCATGGACTCT
GCATCTGATACTGGATCCTCTTCGTACTCGCCCGTGTAGCCGATAGTGCCGAATCTGTCGAACAAGATGGAGAGCGTCTCAAGCACGGTAGTAAAGTCGG
CGCCGGCGTCCAGTAGATCGTCAGGCTGGAAGATTTCGCCCTCGTTTAGACCCTGCTTCTTGCACCATTCGAGGAAGAGACGAATATTGGCTTTCGAGTG
GAAAACCGTGTTGAGCTTGTTCACTTTGAGATTGGCCGTCGGGTCCACACCATTAGCGAGCAGACACAGTAACTGGCCGTCGCGAAGCATAACCGACAGG
TGCTCGCCATGATCGTTGGCCGTGGCTGTGACGCTACAGATCCACTCCTGCAGCTCCTCTGTGCGGCGCACCGTCATGCTGAAAAAGAGACCGACTCTCG
ACTAGATTGCGTCTGTTGTCTAGCTGGAGCCCGTGGGAGAATAAGACGAAGAGGGAAGAGCCTCGCTGGTCTCCTTTGGCCTCTCGTAGTAGAGCGCAAG
TTCGCGATATGAGCGGCTTCGGGACAGTGCACGCCTCTCGACACGCGACGACGAGATTTTCCGCACTACCAACACGACTCGACGCTGCACGACTTGCTCC
ACTTGGCGCTGGACCTAACGGAAACTGACTCCTGCAAATTGCTGCCAATCGCGAGTTGCCTTTTTGGCAGAGAAACCTTCCCCTTCTGTACTCTTTTACC
ACTTACAAAATCCTACTTACAGGGCCTCGCCAGCTGTTGGGAAAGACTCTGAGACCAACGAGAAGGCGACAACCTGCTGCTGAGCACGGTGAAGATGCCG
AGACATACACTCACGTCGCTAAATATCCGTAGGTTGGAAGCGAGTTTGAAGCCAAATACGATGAAGTACCCGTGAAGCTAACCTGCTAGTTGCTGGATAG
CGCACGTTTCGAATGGATATTTGATGCCGTTCACGGAGCCGTTATGGGGGAGGAATGGTAACAACACAAGATGTTGGCAAACTGCCGCAACTTTGTGCCT
CAAAAGTGCTGGCATTCGTTACTAAGGTAACTAACCCTTGCTCACATTGACATTGACTGCAAAGCCTATCGGGCTAACAGGATGGCATGACTCTTCCATC
CGCGGAAGTGGAAATCTCCGGTCAGTAAACAGCAACTCGACTTGCCACAGGATTTCATCGTTGCCATCGCCACAAACTTTGTGCTTTGTGACAAAGCACC
AGCTAATATTGCCAATCAGAGCGAACCCACGTCTAGTCTGCTATCTCTGATCCTATCCGGAGGCAATCGACATCACAAGCCAGAAATTGGCAATTGAATT
TGTGAACGCAATTTGCCTTAGGCAACTGCCTCACATAAGCACCAAAATGGTGGTCTGACACCGAGAAGCCAGACTCATCAAATACTTCAGAAGTACCAGG
AAACTTGAGTCAAGTCAAAGTCGATATTTTCCACTGCAACTGCTGCAAACGTAACATGGCTACACCGAAAACGATTCAGCTTTATCGTCAGCCAATCAAA
CGCCGTCTTGAAGTTGGTTCGACAGAAGATCGTCTGGTTTGGGTAATTGTTTATTGAGAGAAGAACGATGCGACTCCTGCGGCTAGTGCTCAGCTTCGCG
GTGCTGCTGTCCACGACCAAAGCCAGCATCTTCGCGGGATACACCGTGGGTCGACAATTCCAGTACATCGGCAAGTTCTGCTTCTCCTGGACGTCTACAC
TCGACGACATCGCGGGGGTACGACTAAAACCTAAAGCGAAATATCCAAATCCTTCTAACCTTAACATTCATCCTTTCTAACGTTGCTACCAGCGCATTGC
GGGCGAGATCGAGACGGACGTGGATGGACTCCAGGTCGCCATCTACGACGACGAAGCGCTCTTCTGGAACTTCGTCATGACCGACATCTCCTGCGACTGC
TATTGCAAGGTCTCTGCCCAACACACCAAAGGCGTCTTTAACGTGACTGCCACCAATAGTCACCACGTAACTCCGTTCACCTTCAACGTGGACATCCGCG
AGCATCTACGACCAAGGTTCTGGTATGTAGCGCTCGCACGTTGTGTACCGGGAGGGGACCAGTACAAACCCTCCTTCACAGAGATCACAGAGACCAACTT
TCGCAAATACTACTTCTCCTCATGGTTTAAAATCCACATGACGCAGGGAGATGGGAGTGAGCTTCCCGTGCAACAACAAGGGCTGCCAGCCATCTACGCA
GTCATGGCGGCGGTGGCAGGAGCTGCAGCAGCGGCACAACTTGTGGCAGTGCGGCGCATGAGACAAAGCGAGTCATTCCACCCGATCATGCGGATTTTGA
CGCTAGTGGTGCTGTTTTTCTTCCTGTGCAACGCGCTGCTATTCATTCACTTTACTACGTACGAGTTCAACGGTCTGGGGGTACCGTTTTTCAAGTACGC
GGCTAGGATCACAGACGTATTTGTCCGCGTGGGCACCTTATTACTGGCCATGGTGATCGCAAAAGGGTGGACAATCAACAGCGTCACACTGGATGGCCAG
ATCAAGCTTTCGTGTGTTATTCTAGCCATTCTCGTGCTGTATTTGTCCATGGCGATGTGGTATCTCGTGTGGCTCGACCCAGCGTCGACGTTGTACATTT
ACGACTCGTGGCCGGGACTTGGCATTTGCTTGTTGCAAGTGTGCGTGCTAGGTTGGTTCGTCAACACCATTCTAGAGACGCGCTCCTACGAGAAAGCCTC
GACAAAGCGGTATTTTTTCCTCAGAGTAAGTACTGGAAGTGATACTTGTTATCGGACGAATCCTGTACTTACTCCGCGATTTTCAGATGTGCTGCCTGTT
TTCGGTGTATTTCGTAGCCCTGCCTATTATCGTGCTCGTTGCTTCCTTCTTGTCGCCGTGGGTGCGTGAGAAGACCGTGGCTGCCATGACGACCTCAGTG
CACTGCTTTATCTACTTGTCTCTCATTTACACGCTGTGGCCGACTAGAGCACCACGCTACTTTGAGGTACGGAAACAACTGCATTTGTTGGTGGGACTGG
CAGGATCGCTAAGTTTCATTGGTGTCGAACATGTAGCGCCTCTATTCCGTGTCGTCTCCATCCGAGAAAGCGTCGTTGCGTGACCAGCATCTCCCGACCG
AAGAACTTTAAACCGCTCTCACTGGTAGTGATGCTCTCCAATTTGACGTAGCTAATAGTTGTTTTTTTTTTTCGTTCCAGTCGATTCAAAACACATTGAC
GCAGTTCTACATGATGGTCCTGTTGAGATGCATTCTTGTCTTCCAGTACAGTGTGAGCGTTTGAGTCTCCAGGTGCGCCAGCTGTGAGAGTGCACGGAGA
ACTTCGTCGGTGCAACAAGCCGAGTTTGGGTCTTCTATACTTCTGATTTTCAAAGTCAAATCCTGTGAAACAAACCAACACACACGAAATTAGCAAGACC
GAAACAGCAGTCTGATAAAGCGGCAAACAAACCTCCAGGAGATTATCAAGATCCGCTATAGGCTCCAATATTTCGCTGACATCCAGCGCTAGCTCATCAG
AGCGGTCTTCTTCGTTGATTCCTGTAGGGCTTCCATCGTTCCAGTTATTGATCGTCTCCAGAACCAGGGCTCGCATCTGCGCGATATGACAGTGTAAGTA
TTCCTAGAAAATGAGAGATGAGTTACAGTAATGACGAATACTTACCGCAGAGAGATCGGCCACGTCGGAACATTGAATAGTGAGGTCAACTGATCGTTGT
TGGTCTTCTGAAGGAGTGAAACGAAGGAGTATGAGGCTTCCGGAAAAGGCTCGTAGTACCGTCCAGAGCTTCCCATGCTGTGTTCGGCAGCTACGACGCA
ATCGTGGAACCTCAGCAGAGGGTATCTCCAGGAGCTGACGCAGGAACGATACCATCCTCTCGAGGCGGAGTTTTTCAAAATTCTCATCTTCATCCTCGTC
ATCCTCGTCGTCTTCGGTGGCAAAGAATGAAGGGATGGCTATAACAAATCGGGACGGAGGAGTTAACGCCAGAGGTGCAGCGTCAGAAGGCGAAATTTTT
GACCATAACGCTGCGAACGATGGATTCCTATGAGCATGGTCAGTGAGTGCAGCCCACCACTGCACACCACTCCAGAGAACAGACGAAGACGATTTTCCCT
CTTTGGTTGCTCTACCGACTGGCATGAACGGCTCGTGGCTTTGGCGGAATGCAGCGTGAATGGCAACTTGGCTGGTTGGAATCTCTTCCTCGATGGGCCG
ACTCAGCTGTGCGAATAGGAATCTTTTGTCTTGAAGCAGCGGAATTGCGAACGACAATGGATCATCCTGAGCAATAATACTCGCACCAATATGGCTGGTA
TTGGACCGTTCATTTTCTGGATATCCATTTCGTGAAGGGCAAAATACCATCGAACACGAGACCCACAAACTTCCCTGGTCTTGCTGTGTGAGTGTATCTG
GATCGAGGATAATGCTCTGTTCTCCGCGCGCTGTTATATCGTTCAGCGGAAAGGAACAAGTCGTGATTGAACGTTGATGAGTACGCACGTACAGACACAA
CCACCTATGCCCGCAAAAACATGGATTGAGTGCCAAGATTCTTAATGAATGTTCATGTGAATGAATGATGCACAACAGCAGCCACGTACCAGTCGTCAAG
TGAGATAATAGCTTCGGGATTCACGAAACCAAAGGAGCAAACCAGTTGTATCGCCTGTCGATCTGAAAAGATCCCAGTCATTGTCATCGAGGCATTCAAG
TTGCACTTGACCACAGACTCCACACCTGCAAGGAGACACAGCAACAATTACCAGTTGAGACGCACAGATGCTGCTGATATCATGACCGATAACACGAACC
TGTAGTTTCGACAAGCCGAAGTGTTTCCAAAGCAGAGTGCAATGTCTTGAGCTGGAAGTCCATTTGCTTCGATTTAGTGCGCAGATTAGTTGACTCGGAG
GAAATTTCAGCGATTCGATGCAAAAGATTGCGAACCCGAGACTCACTCCCTAGTTCGGATGACTTTCCACATTTATGGTTTTGTTGTTGTCCAGATAATG
GTAGTACACTTGTTACCATCGTGTGAAGAGCTGTGTTATTGATTGTTGTGATCCGCCCTGACGCAAACAGAATTGACAAACCACCTTCACTGCCATGAGT
TGCTAAGCGGATGATACCCTAAATCTCACGCATACCTCGTCAACTCGGATTTCAACTCAACGAGCAAAGGGAAGGTGGATGACACGTACCAGTTGAAGGG
GTAGCTTTTCAGTAGAAACATTTGAGCCATCACTGAGGCTAGTAGGCGCGTTTGAATCTATGGATTGAGCTTGAGATAGTAAATCGGTGCTTCGACACAC
AAACGCTGACCCAGTCGAGCAAAAGGCAAACACTGCCAAACGATATACAAATACCAACGACTGTACTGCGCACCCAAGCTCCAGCTTCTTCACTGAACCA
GAAAGGGCTTCCACCGAGCAACTTTTCTTCACTTCAACAATCCTGATCCTGCCTCGAGCACCCAGCACTAGCAGTGCATCAAACACTTGAGATGTCGCTG
TTGCACCATTTCCTTCCGAGGATGTAGTTGCAGACGACGAGAACGGGACGATCATCTGAACCGGCTCACCCAGCCGAAGCAACATACCACTGCGAATTAC
GGACGCCTTGATACCACCTCTTTTCTTATTTGGATAATGCACCAATGAAAAACGTACATAGCCATCCAAATCTCCCTGTAGAATAGCGGTCACACCCCAG
TCGGTCGCCACGTCCGGAAACAAACGCCTCAAAAGTCCACAATGATTCGCCATCTGATCATTCAAACAAAGTGTGCAAGTAGACTGTTCTCCTTCGAGCT
CGCCCAGCTCCAGCGATTGATGACGCTGCAACTTCGACCCGGAGCTCCCGTAAGTGCTCACGATCAGCGTGGTCGGTGTCACCAAGCTCCTCATCAGCGT
CAGCGATGACAACCCGGGTCCAGCAGGAATGTGACTCACGGATTGCACTCCAGGCAGTTGACAGAACCATTGGACCGATTTGTCATCATTCTCACAGGAC
GAGCGTTCCAGCAGCAACTCACGTGTCACCCCAAGCTGCAGATGACCAGGCAACGTCACGACCCACACATTTCCGTCTGCAGTGGATACCAGGAGCTTGT
GACGAGCTTCACCGTGTTCAGAATGATGGCCGCCATAGTCTGCGACGTCCGTGATTGGCACATTGGACCTGATCACACACTGAAAGAGGATTATAGACTT
GCTTTAAGGATCACTGTTGCGATTCACTTACCCGCAATAGATTGGCAGCCAGGAAATGCAGCAGCGTTGGGCGGATTTTCACGACGATGCATGCGCACGG
AGGTGCATTGTCTGTTGTGTCATTATTGGTGCGTAGAGTTAACAGGAGCGGCAAGCAGTCAGCCACACGGGCCAATTGTGTCGACGAGCTCGCCATTCCA
ATTTTTTTATAACTAGCTGGGCAACATCACTGGCAAGAATTTTTTTTTCAGAAAAAAGTGCTTTATGACGTTTTCAGATTTTTTTTGAATTCCATTCCGA
TTCATGTCCTTAAAGCCAGGAGCATTCAGACGAAAAAAACATTAAAAATTAAATGTTTTTTTTTCGTCTGAATGCTATTCCGGCCAATCAGATCTCCCAT
GGCAGTCAACCAACACAACTTAAATGGGAATGGAAAAATATTTCGAGAGATCTGAATGCCATCCAACGGCAAGCGACGTGATGTTTCAGGGACGATAATC
GCCCAAAACTATGTACTATACACAATTTTGGGCGCCCTGGCCAATGATTGTAAAAAACTATTTCGGTTATTTCCGATATAAAATAGAAATATTTTTTTGT
TATCTTTTATGCGATAACCTGTTTATACAATATGGTTGAAGTACTGCTTCATATCGATTAATAGCCCCTACTGAAGCCCTATGATGGAGGGCATTTGGTG
GATAAAGTGATAGCGTCTCTTGCTCTTTCGCGGATGCAGACGGGATCGCTAGACGCTGCTCGACGCTGCCGCCGCTCTTCTTTAAGTATTGCAGCACGCA
CAGCCACCGCGACGCTCACATTGATGTACTGGTCGTCACTATATAGAGATCGTGCCTTGTAATAGAGGTGGTTCAAGTCATACAAATCTGGAGTTGATAG
ATGCAGCTGTTTCAGGTACACATACCACATAAAAAGAAAAAAATATTTATATAGTTTTTTGACCATCCCTGCCCACGCGTCTCTTTGCCGTAAGATCGAC
TCGCCATGGTCAAGACAAAGTCAACGACTTCCATTGGAGGCAAGTAGCGAACGACCAAAGGTAAAAAAAAATAGACCTGTAACGATACGCACCGCTACCC
TCATAAGAAACAAAGTCTGATTAAACGGACGTTCTTGACTATCATGTATTTAGCGCGTAGCGTAGCGGACAGCCACGTCACATCAAATACAACAGGTATG
TGTATTACTTGATTCTGTTATTACCAGGGAGTTGTGTTTCTTTAGTGCTCTATACGTCATCGACCCCTTGGCGATTCTCGCGTCCAAGGCTGTTACATTC
AAAATCGAGTACAAAGTTTTCTATGAGGACGCGCAGGGCTCCATCGAGCAGAAAACTCCCACGCACATATCCAGCGAGCTCAAGACCTCGACAGAAGCAT
CAAACGTCAATGCTACTACAAGCACAGAAACGAGATTGCAACAGGACTGCTGTGCTCGGGACGTGAAGGCAGCGAAATGTCTTCGCTGTAAGTAAAATAT
TATGACATAAGAGTGACTATATCTAACAATTAAGAGTTGCTTATCACAGTTAAGCACCTCAAGGCGCTGCACGTGCTCCAAGCTGCACATGCCCGCAGCT
TTAAGAAAAGCGAGAGTCGCAGATGTGGTGTAGCGATTTCCGAATAATCGCTGAAGTGGCTACATTCAAGTTGCTCAAGCCACGAACGCTCAAGAAAGGA
CAACGAGGTGCAAGAAAAGCAAACTTCAGTGTAGGTGACTTCGTTCTTCACTCACGAGTGGACCAGAAACACCAGAACAAGATGTTGGTGACATGGAACG
AACCGTTCCAAATCGCGAGAGCAGACATGTATTCGTTTGCAGTCAAACACCTTGTCATGGGTGCAGAGTCGGACGTGCATGCGTCTCGGCTAAAGTACTA
TGCTGACGAGGACTTCGAGGTGACTGAGGAGGTTATCGAGCATGTTGCATCTCAAGGGATTGTACTGGCGGTTGCTGAGCTTAAGGAACACAGGTGGTGC
GCGCCAGCTGTGAGAGTGCACGGAGAACTTCGTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCAAGAAGCGCTGTACAATGGACACAAGCGAGTGCATGCATTCAAGTTCCAGACGGTCGTGGCACCTGACGGCATC
ATTTGTCATCTTTTCGGCCCAGTGGATGGAAGACGTCATGACATATACATGCTGAGACAGAGTGGCCTACCAGAGTTGCTTGAAGACAATTTAGAGTTTC
ATGGGAAGCTGGTGTACGGTGATCCTGCTTACGGGTGCACTGACGTGTTCTGCTGTCCCTACAAAGGTTGTAGCATTAACCCTCGCTAGCACGCGGTGAA
CAAGGGTATGAGCTCTAAGCGTGTGTCGGTGGAGTGGTCATACGGCCGGATAACCAGGTAGTTTTCGTATCTGGACTTTACGCGGCACCAGCAGCCTGCA
ACGACTCCTGTTGCTACCATCTACAAGCTCGGGGTGTTGTTTACGAACTGCATAACGATTGTACGCGGTGGAAACACAAACTCGCTCTTCTTTGGATGTA
AACCACCTACGTTCGAAGAGTACTTCAGTTCTACCACCGACTAAGTCGATAATAATTAATTCGTTGGCTTTTCTGCGTCGTAGAATATCAGGAGAAACTC
ACCCACGCACACCAATAAAACTCTGAGATTCCCAGCCGACAGCACTCGAGACGCCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAATTAATTCGTTGGCTTTTCTGCGTCGTAGAATATCAGG
AGAAACTCACCCACGCACACCAATAAAACTCTGAGATTCCCAGCCGACAGCACTCGAGACGCCGGCTAGAAGTAGCAGCAATTAGTTGCTAGCTGGAAAA
CGCTCATCGGCACCCCTGTTGCCAACTTGATTTTGAGAAGCCTGTAATTGCAGCCTTAATAGTGCAATTTCTTGGCGCCGAATCTGCATTTCCTGGCGTC
GTAGCTCGACTTCGTCGTTCTATTTCCTTTCAGCCAACTCAAGCTTCTTGCTTTTGAAAGCGAACTCGCGGTCCCAGCGAAGCGCTTCCTCCTCACCTTT
TTGCTTCATTAGCTTCAGTTGTTGCTCTAGTAGCGCGTTGTCTTCGTGGTGACTCATTACCTGCTGCTCCAAGTATGCTGCCAGTGATCCGTCTTGAGCA
GCTTTAGCTGTCTTGCTGTTTTTGCGATTCGAAGTCCCCGAATAATTACCCGAGGAACTGTCTCTTGTCGAACCCGAAACGATCGCGCTTTCGGTACTGG
GTGCACTCGATGAATCCTGCTTCGACTCCTCAGTAGCTGCATCTCGTTCCGATCGACGCTTGACAGCCATTTCCCTCAGAATCGCACCCTATGTCTGCAA
TCGATCCTCCTTGTCTTTCTTTTTCTGCTTCTCGTCGGTTTTCATCGCCTTCACGTCTCTAATTCGGTCCGATAGATCTAGTAGCAATTGCTTGTGCTCC
TCGTAGTTTTTCGCTACTCATGTCTTCTTGCGGTAGGCCTGATCGTTTTGTTTAAACTCATCCAGGAGCAGTGCAAACCGCTCTTGCACTGTTCTCTTGC
TTAACTTCTGGTCTAATTTGAGGTGAGCGCTCAGATTATCTGCCACGAGTTGATAGCGAGCTCCAATTTTGCCGTGGCCTCCTGCAAAAGGCTCGTTGGC
AAGCATCTCTTTAAGGAGCGCCAGATCTGCCTTCTGGTCAAAGAAGAACTTCCTTCGCCTCTTCTTGTCAGCTTTTGATGCGATCTCGTTCTCCTTGTCC
TCGTTTTCGTCGTCGTCATCAGACTTCTTGCTGCCCTCGTCAGGAGACTCATCCCACGAACTTAAACTTTTCACATCAACACCAGCAAAGTCATGGCACG
TAAGTTTGGCTTTGATACCACCTTGGCCTGCGCTACGGGGGCGCTTGAGGTTTGAGTAGCGGCAGCGTCAGTAGACACATCAGCAGTAGAGTTCGATCGC
GAGCGCTTGCCAGCAGATCGACTGTTATTCGATGGCTTGAACTTGGCAGCTGCAGCACGACTGTATCCAGGCTTGCCATAGCGTGTTGTTTCCTCAACAC
TTGGCGCGCTAGTACTAGAGGTTGATCTCGGCGTGGCTGGCTCAGTTGCCAAGCCCTTGTAGCCCTTGGAGGTGCTTCCGGAGATCAGACCGACGCTTCT
TCTTCTTTGACGCGCCCCTTGGTAGCCACAACGCTTGTTTCTGATGGAGCGGAGTTGCCATCGGGAGCAATGGCACCAGAAACGATGCTGGTACAAGCAG
GCGAGCATGCTCTGGAACCTAAATCACCATCGAGCACACTGTTCGAGCAGAAATGGTGAACGTAGTTCCCGCAGCCCGGAGCTGAGCACTCTTCTGCGAC
CAGCACTTCATCATCAGCTGCTTCACAGTGCTTCTTTTCATCGATGTAGTAGGCGCATGGGCCTTGTATCGTCTTCGACTCGCCAGGCATGTCCAGACAG
CAACTTATGCACCCCGCGCAAAAAGTCCGTGCGCTTATCCCGTAGCGAGGGTGCTGGGCACGGGTTTTCGGAGCCGAAAAACTCGTCCGAAGAGGCGCGC
CAGAAATAGATCGCCGAGCTACGTGAAAATGACTACAAGTTTTTTTGCAAAATCCGGGGTTTGAAAGGCTCTAATATCTTCCGAAGTATAAAAAACGTGT
TGAAACCCACAAGTCGTTATTTTGCAAATCGGTTTCATTCGTAGTACAGTTGGATCTGTCAAATCGACTAACAGTATCGCTATTTTAAAAAAAATTGTTT
GTATTTTAAAATAAATTCATCATTTCAATTTTTCTTGCAAAAATATATTTATTAAAATATTATTGTGTAAAATACCGTCGAGACCTGAACATTGCGATGG
TATTCATCCCGAAATTATGGGTACCCTAGACAAAGAATGGGTAGGGTGCCATTCTTTGGGTACTTTGCGCTACTTTAGGTCGATCGCAAAGTAACGCATC
ACAAACCGACGCGGGGCCGCGTCGATGTATGGGATTTTATATTAGAATCTTACTGAAACCAAGATGCGGGACCCCGGAAAAAATAGTCCAGAGAGATAAG
CCTTATTTCAGGGGACGATTCCTTTTGTGAAGGCCGTCACAATTTGCACGAAGCCAACAGACCATGGAGCAACTCTCCGAGGGCCTCTTGGCGCACCTCT
TCTCGCTGCTTTCCGCTCGGGACGTGCTCCAGGTCGTCTCCACCTGCCGGTCGCTGTCTCCATCCACTCCATGCGTCCAATCAGCGCTCGAGCGCGTCAT
CAATCATCGTTTTGGATCCGTCGCGAGCTTTTTAGATGCCTCATCATCCCATTGGCCACGATCGCTTGCTGTTTTACGCGGTACCGAAGTACTACGCATC
AAGGAGCTTCTGGCGCGCTCATCTACCTGGTCATTCGAAGACGCCGCCTCATGCTCTCCCAACTGCGTCGTCGTGAGCCGTGCGTGGCTTGGCGCCTTCA
GGAAGCGCTGCCAGGGTTTCGAGCAGTATTTACAGCAGTTCCGCCGTACTAAAAGACAGCAGCGGCGGCAAAATGCAGCTAAAAAGAGGGACAGTGTTGC
ATCCGAGAAACTAAACCTTGCAGCTAATTCGACACTCAGCGAGGCCGGAGTCATGATCGTGTGCGCTCACGACGCACTGTTACCGGCTACTCAGTGCGTT
GGTCGCAGTCGTCGCGCTATTATCAGTGGAGACGTGTTCAGAGAGATCGCTGTCTACGCACCGGAGCTCAGAGGTTTCAGCTTGAGATCGTGCTGTGATT
GTACCATGTGTGTACTGGAGCAAGAGACGAGGGAGCTGGAGGCTGAGGAGAAAAAGAGAGTGAGATTCGACGCGGAGATTGCAGGATCCGAGGAGATGTT
GGAGCTACTACAGAGGAAGAACGGGTTCCCTAAGGGACTGTTCTCGCCTGTGGACACAGTGGGAAGCAGACAGCAATTGGCACAGCACTGGTCGGTGAGT
GGAAGGAGCAAGTACGCGACGTACTTCTTGGTGCCCAAGAAATGGTTGAACAAATGGAGGAAATTTGTTCGCAGTCAGGGAGACGATAGCCCCGGTCCAG
TGCTAAATGCCGAGCTAGTGTGCTTGTCGCACCAGAAAACCATTATACCGCCCTATATATCAATGTTCCTGTCCGGGTTTTCCCTTGAACAATCGCTCAA
GGCCACCCAAGCGTAAGTCATATCTGCTTGAAGGTAGGATTACATTCTTACTTACTGTTATGTTGACATGCAGTCTAGGATCCACCCCAGCTCGCCAATA
CGAGATCGTGACATTCGGGGAATGGGAAGCGCTATACGATCGGTATTGTGCTGAGTTTGCCGTTGGCTTCGACGTGATCAATGGGGCATATCACTGGAGG
ACACAAGAGTGCCAGATATGCAACTATGGAATGGGTGGCGGCCCATCGTCGAATCAACCAAACTCACGGCGCTGAAGTGGAATCATGAACGATCGTACAC
TGTATAAGGCCTCGTTACTGCTTCCATGCCGAAGTAAAAGAACGCTGAGTCAGTCCCCTTGACCACAACTTCGCCAATATTCAAGCAACAAAACAGGGCA
TACATACACTAAAAGTATGCACACTATATTCACGGATTCACAAACCCTAAAGTATCAGCTTCCGTGCCCCCTGTCGAATCTATCGGCGGTGGCTGCTCGG
TCGAGATCTTGGTCATCGGCCTGCATTGACTCTAGACGTGGTATACTCAGGATGACTTTCAATAATCGACTCATCCATGTCTCCCTCTTCGATCTTTGGC
ATCATGCTGGCATATTCGGGGTCTTCTTCCTCGTTGAGCTTCGTACGACGGAAGGCTTCCATCATAGCGGGCACACTAACGTTATCGAAGCTCAACTGAC
CACCGTAACGCAGCATTTGAGCTTCGTAGGCTGCGTAATTGTAGGCCTGGAACCAGCGCTTTCGCACTTCTTTTTGAACTTGTTTCTTGCGCTGTGCTGT
CGTCTCAGCAAATATTCGTCGTGACTCAGCGAGTCCTTCTCCTATGATCATGCTGATCCCAAACATTGTGACTGCAATGCACGTTCCTACAAGTAGGAAG
CTGAGCAACTGCACGTTGATCAACGACTCAACGTTTAGGTCGTTCAGTCGAATCATAACTCCGAGCCACAACGTGAAGAAGAGCTGCAACTGGGTGATAC
TCGCGATGAGATTATCCGAGTAGCCGTCGTACGGTTGGAAGTATAGCAAGAACCACATCGTCGTCAAACTGTATCATGCAAATGACACGTCAATACTGGG
TTACTCTGATCTAGCAGATAGAATCCAAACATACCAGACAGCTAGTGCCAGTAAAACTTGCTCCACACTTCCGTTCTCCACGAACACGATCACACCACTG
AGGAAAAGCTTCCGTGAAAGATCCACGACTTCAAACCACCAGTAGTCATGAGTATCTGCAAGAACAATCACAAATTTTAGTTACGTGTACGATCCAAAGG
AAACTCAATAAAGCGTACATTCGGCGTAGATAAAACCGAGCCGCGCTTGCACCGTCGAGTCCTATTGACAAAAAATATTGTAAGTAAAATTAAAAGTTTG
CGGGATTGCTGTAGCGTACTGTCAAGTTCTTGCGCTTCATGTACTTCGTCAGCTCCTCGTCCTGCACCTCGATGTTTTTCATATCTCGAACAAACCGTCC
ATCTGCTGTCTGTTGTTCTTCCACCTCCTTAAGCCACTTATGCCGTTGCATGCGCATCTGAGGCTTACGCAGTAGCTTGATACGCGCAGCAACTCCACGG
TCCTGAGCTAGCCAGATCAAAAGTCCGAAGAAGAATGGTATTCCCACTACCCAAACAATGACTCCGATCGTCGCAATCATGCCAAACACCGCCCATTGTG
CATTGTAGCAGATCAAACGTCGATCTGCCACGAGATAAAATACGTCACCAACCTCCTGGCAGTTGTAAACTGTCAGTATAGTCTTGGAAACGGACGGGTA
CAGGAAGAGAGCTATCCAGCAGTAGAGCTTCAGACACTTGTTTCGATACGTCAGATAATTCATGCGTAGCTTCACGCGAGCTTGCCAGACGCGAAGATTA
CTACGAATTGTACGATCAAGCATCGCACCGGAGAGTTTATGTCGTTTTGTAGGACATTTGGCATGCACTGACCGAAACAAACCCAAATACGGGGTTCGGA
CTTGCGACATACCGAATTTACGCTTCAGGGCTCGAGTCTCTTTGAGAGTTGAGAGAGCAGCCGTGCCTTCATTCTCTGGACCACCCTTTGCAGCTTCCAC
TGGACTAGATGAGCCAGACCGCTTATAGAAATTATACGTCCGCCACCAACTGCGTAGCAATCGAAGAGGATTGAAACTCTCGTCGTCGTTTTGAATCACT
TCACTTTCCAGAACCGGAAGCCCGCAGCGCAGACAGTTACGAGGAATTAGCTGCAGTTTGGAGCGATAACTGCGCATTCCGGCGTAGAAGTACGCGGTGA
TGACAGTAAGGGCGAGTACAACCAGGATCACGGTCACCCTGACGTAAAACAAAAATAACAAGTCAGACTACGATGAACACATGACAAACGGGTTGCAACT
CACGTGAATTCAAAGTAGAAATTTTTCGTAACCACACAGTCGATTCCAGCGATGGCCACCAAATCCTACTCATAAAACACGTGCGTGTTATTCGGTAAAT
GAGAAATCAGCAAGAGGCTTGCGAGCTTCATACCAGATTGAACTTTTGAGAAATGTTCATAACATCTTGAACATTTGATGACCACTTGACGACGAAAGAG
CTTTGGAAGTTGCCAAATATCTGGAAGAACCCAATGAAAATCTTGAACTTGCTGGGGTTTACTGGGAACGTCCTCGGTGGAGGACTAACATCCACCCCAA
ATACCATTTTCACATTTCGACTCTGATATGTCTTGAAAAATGCAGTGATCTTGTTCTTCACTTGATCCACTCGCCCCACCACTGCCATAGATTGTCGCCG
ATACTTTGCACCCGCACGTAACGCGATATGGCCACCCTTCTTGGAATCAGGGGCTTTGAGTCTTCTATCAGCTTCAGCTTTCGCCAGCAGACCAATTTCT
GTGAGATCACGTAGATAAAATCTAACACTGAACACTCCTCCGATAAGTGCAAGAACCAGCAGCACAGGTATAACGAAGTTCTGCCATTTAATTGAGGCTC
GAACCTCAGCGTTTGCCTCATTGCAAGCTACACAGCACAATCAAAAACCATTAAACGAGGGGCATCATGCTGATAACTTGAGAGCTGAGATACTTACGCA
AACAAGAATTATCCCTGGCCCGCTTGTATCCATCGGCACACACGGAACAAATAGCCAAGTCGTACCCGCTGGTACAGGACACAGTACTCACTGCTGCTGC
ATGTGCGAGCATTTGAACCGTAACATCGGCTTGGCACGCGCCTTCAACCTATACACGCATTAGCCAAGTACAAATGTCAAAACCTAGCTCCAGCTTCAAT
AAGTTTCCAAACGTACGTCGCAGGTGTAGAAAGATTTCCCAGATAAGCAGGAGAACAGACGATCTGCCGACCAGTATACGTTGAAATCGTTGAGATTGGA
GCACTCATAGATCATATCTGAGAGGTTCTTCGTTGGGTTCTCCAACGCAAGGTTCTTGCATGGATCTTCGTCCTTCCACAGGGATGGTTTATTGCAGCTA
GATTCTTGCTTTGTTGCTGGGGCTGAAAAAAGATAATACCCTTCCTCTGTCCGTGGGGATACCGTACCGAGTTCTTCGGCAATCGTGTCCGTCCCACGGC
GTACGTTCATATTACACTTGGCGCCGGAAGGACAGTCGAAGCACTTTAAACCATCCAAACTGCAGTAACAAATACGAAAGTTAGTATCAAATAGTCGAGT
GCAATATCCACTGAAAACTAAGATAATACCTGTACATATTTTTTGGACAGCGTTCACATACACTGTAAACATAACCAACGAATAAATATCAGTGCCACAT
TCGTTACCAGTCTCCTCGAATATCTGCAGATTACCCTTGATTGACTGAATATCCTGGCTGACACGGCAGAAGCTTCACGCTCTGGACGAAAAATCTCCTT
TCAGATCTTGGCAGTGTACACGAGATATCGGTCGTATAGATTCCTTCTTCGGGAGTTCGGTTGGCTGCTGTAAAACTGGCCCCACGATAGGAAATGACGC
CACCGGCAGACCGGATTAAAGCCCGCGGCTCAAACAACAATCGCTCCGTTTGCTCACTACACAAACCGTCACTCACCATGCATTCTGTCTGATTGTCGAG
CACTTCAACCTGCCCATAAAGATCCACGGCCTTAAGTCGAGGCCATACATGCATTTTCCTCTCTAGGCTTTCGTTCCGTGTTTTGATGGCCTGAATTGAT
TCCTCATCAGGAGGCTCCAGTATAGGCACGCCACTAGTCATATTTTCAGGCCACCACATCACTTGGACATCACGTGTATTTGTCGCAATATCGTACACTT
CGTTAAATTCCATCGTGCAGGACGTACACGGGTACGTAGGAGTAAGATCTTCATCCTCTGATACCCAAAAGATACATCCTCCGCTAGGTGCAGTGTTTTC
TTTGCATGTGATTCTTGTAATCGTGGCATTATCAATCGATTGGTAATATATCGCGCCACCACGAGTGAACGCAGAGTTCCTGATAAACTTGGCGTCTGAT
ACACTGGTCGAGGAATGATCATCGGAATAAAGGGCGCCTCCAAACACAGCGATATTGCCAGCTAATTCCCCCGCTTTCATGGTAACTTTAGCTTGGTCAG
TAATAAAGAGAGCTCCACCAACTTCACTGGCTCGGTTACTGCGGAAATCGACCGATGTTAAAATAAAAGTGGATGTGCCAGATACTGCCATTGCTCCACC
AAAATGTGCCACGTTATTTTCAAATAAAGTTTGCAACGCAATCGTGACTTTCGCCTTCACGCTTGTTGCAATCGCCCCTCCGTTTTGATCTGCAGTATTC
CCTTCGAACACGGAGCTCATGATCGCTGCTGAGCCTCCGCGATCAAAGTGAATTGCCCCACCAACTAACGCAGTGTTGTTTATGAAAGTACAGCTTGTGA
GCTTTACAATGCCATCAACACAAGAAATCGCCCCACCACCTTCATTTTTACCGCTTGTAGTCACGCCTCCATTTCCAATGAACTGAGATTTATACCCAGC
CAAAATCGCCTCTCGTCCAACAAAAACACCTGGGGATAAATAATCATAACAAACAGTTAATAGTCAACATATTTTTAAGAGAGGTAAGAAATTTCTTACC
ACATCCTTCTCCATGAGCGAAGTTGCGTTCTATGAAGGATCCATTCAGAGTGACAGCATTTTTGTCTCCTGTGTCGATGAAGATTCCCCCTCCCGAGTCA
TCCGCAAAGTTGTCAGATATATTGGAGTTTTCAGCGTAAAGCTTCGATGATGACTCCACATAGATCCCACCACCAGACGTTTTAGAATCTGGAAAAAAAA
AGCGTTAAATAAAATCACACACCAATTATTTCATACAAACTTACCGCTGAGTATCACTTTAACAGAGGTGAAATAGGCTTGGGCGCTGTTCGATAGACAT
ACGCTACCTCCACGTTCGTTTGCCGTGTTGGAGCTGATTTCGGAGTCTTGACTATAGAAAAAAGCATTTGCGTTGATGTAAATTCCTCCTCCAGCGGCTG
CCAATCCTTGCGTTGCGAATGATGAGAGCAGCTCTAAAACAGAGTCTCTATCTGAGAGATAGACAAGGTCTCCTTTTTGAACTTCGACCTTGTTCTGTGC
ACGGCCTTCAACATGCTCGAAGCCGACAAGTTTGCTGAACAAGTGTGGCCACGTACCTGTGAAAAATCTACCTGTATCGCGAGTGATATTGGCGTCAAGT
AGACTGATCTCGGACGATTTAACTCCAGCAATGGAACCTCCGACCGGTGCGTCATTTGACAAGAAGAGCCACGTGTCTGCCATGACACTAGAGGGTCTAT
CGGGGTTAACTCGTTTATCTGAAAAAAGTCCGCCACCTATACCGGACTCACTGTTACCGGCATGGTTCTCCATCACCAGTAAAACTGAGCTGTACAAGTA
GACTCCATACAGAGAAATAGCCCCGCCACTAGTTTTTGCAGAGTTGTTGTAAAATACGCAGCTCATGAGGTCCACTTCTGGCAAAAATGCCGAGCTTTCT
GCCCATAATCCACCACCACTGTCGGTTGCAATATTTCCAATAAAGCCCACATTTTCCAGAACCGTCTTTTCCGCATCGCTAACAGCAATCCCACCACCTT
TAATCGCCGAGTTGTTAGCAACAAGAGAGTTTGAGATCACAGCGTTGCCACGACCCAAAACAAATACACCAGCTCCTTGCCCGAATTGTAAATTGGCACC
AGAAATTACACACCCTGACAGAGTACAATTGCTTGTACAATTCATCACAACATTTGCCCCGTTGCCGCCTATCGGTTCGATAATATTCGCATCAATACGT
GATCGTTGAGTGGCGCCATCATCCCAAGATAAAAGACTTGCTGAGTATAGCACGCTATTCAGGTATACGCCACCGGCTGTTGGAGCGACGTTATTGGAGA
TATCAACATTTGAGTGATACAGAGTGGCCTCAAAAATCATTACCCCACCACCCGATTCTCTAGCTTGATTATTCATTACCCAGGAGTCCCGAATCACGCA
ACTTGTACCCGATCCAAATAATAAACCGCCCCCCGAAGTCGATGCTGACGAGTAGGAAATATCCGCGTTCAACACGACACATGACGTCGCATCCTGAGCT
GCTAAACCACCCCCAAATGGTGCATGACTCTCAGTAATCACCAAGTCGCTGACGGTCGTTTCTTCTCCATCAACGAAAACACTCCCTCCGTATTCAACTG
CTCGATTTTTAGTCAAGGACGCTGCATTCAGACTCGTACCAGTACTCTCCTCAGTCGGGTATTGGTAGAATGATGATGAATTGACATAAATTCCTCCGCC
ACGAATTGATGCACAGCTCTCAATTTTCAATGCGTAGTGCTTGACATCAGCATCCACAATCGAAATACCCCCACCGACACCTTGTGGAACCGAACACGAC
TGGATAATTGTAGACCTTAATGAAAAAAGACCAGTTTCAACAGACACCCCACCCCCCCTTTGCGATGCTGTATTCGCAGAGATGGTAGCTCCTTCCAATA
ACGAGATACCGGATGTAGCAACTCCACCGCCCCGTTCTCCATTATTCTGGTCCACTGTAATGATACCCGAAAGACTTGAATCGATAGCATAGACTCCGCC
ACCAACCACAGCACGGTTGCTGCTGACTGTCACAGGTTCTACCTGGATTGTAGAGTTTTGAGCATGCAGCCCACCACCGCTTGTAGTTGCCTTATTATTG
ACAACTTGAACCGATTTCATCGTCGCTGACGAAGCTTCTTGTGCAACCACTCCACCTCCAATAGATGCTGAGCAATTTTGAACATCGAAGAACTCAATTG
AGCTATGGAACCCAGTAATATACACACCACCTGCCGCAGAATCTGCATGGCTATCGCGAACAACTGATGATACATCACTACCTCCAATGACTGAGCTTGA
GCCGATGTACATCCCAGCACCATTTGTAGCGGTACATTCGGCAATCGAAGCTTGCAGTAGCAACACTTTACTTCCAGCATCAACATATACTCCACCGCCT
AAAGCTGCATCACATTTTTCGAAGGAAGGATTTGTTACAGTTGCCGAACTGCAAGAAAACGCCGCACAACCCCCCGATGTTGTAGCTGACGAAGAAACCA
CACGAAGGTTTCGCACCGTTGGACGAGACCAATCACCAGTGTAAAATCCTCCTCCACTAGCTAATCACAAAGGAAAATAAAAATATTACTCATCAAACAG
AGATACGATAACTTCATCTACTTACCTGCTGTACAGTTGGAAATCTCCGATGCCAACGTATTCTCAAATGAGCCGTTGGAAAGGATATACACTCCCCCGC
CATTGCGATCGGCATGGTTCGTTTGTATCGTCGAGTTCTGAAGCACCAGATTTGCCGAGTTTAGCATCGCAATTCCCCCGCCATGGTTGGTAGCACGATT
GCCAATGACTTTCATGCCCGAAAGTGTTGAGCTTCCACTTGTAGCTGTTAATCCAGCTCCGACCAATGCTGTATTCTCGAGAACGTTCAGCGTTGTACCC
GTGAAGGATCCAGAGATGCAGAGTCCACCACCGTTAATAGAAGCGTGGTTTTGCCACAAGTTACTGTCCTTGTCACCACTAACCGAAACTGAATTCTGCG
CGTATATACCACCACCTTCACTTGCTGAAGAAAGCGTGATGATCGAGTCATCAAGAATTAGGTCCGAGTTATCCAAGAAAATAGCACCACCTTTAGCAGC
AGAACACTTTGTGATCTCCACGTTAGTAAACGTCAGCTGAGACTGATAAGCGTAAATGGCCCCTCCATTCTGGCGAGAGTTCGCATTCGTGATGACCATA
TTCTTCATCTCAACTGCTGTATCTGTGACTTTAATTGCGCCACCATCGGTGCTTGCTAAAGTATTTTGTATTCTAAATCCTTCCAGTCTGTTCGGCGCAG
CATCACTTATAATAATTAATCCACGGAGAATGTTCTTGCAATCAACAATTGTCGGAATCGGGCCTCTCAGCCCTCGAATGAGAAGACTAGCGGTTGATAC
AGTAACTCCACAATTGTCAACACCAGTGTAGATACCAGGATAAAGTAAAATAGTTTGTCCGGACGTCGCGAGTTCTAGAGCCCGACGGAGCGATTTGACA
GCTTTTGGGTCTGTTCCACTTGTAGAAGTATCCATTAGCTCGCCTGTTCCTTGAGTATCATCCCCATTCTCACTTACTACAATCACATCATTCTGCGAAT
GGAGGCAAACTGGATCACACGTCGTTGATGTACACGTTGTTAGGTCTTCAGGGCAAATAACTGCATTGGTGCAGCTTTCTCCAATAAAACCGCTGAAGCA
CGAGCAGGTACCTTTTCGACAAGCTCCATTCAGTGAACAGAATCCAGTGGGTGACAGTGGACACGGAGCTGAAACAGATTCTACTGCATCCGATGCATCG
ACGGTCTCATAATGTAGAGCCATCCCTTCGTAAGCCACGCTATCATCCGATGTGAACGACAGTGCCACACTATCCAGACCAGGTCCAGTTGATACGACAA
AGTCTCCTTTTCGATGGCATCCCCCCTTCCACAGCTGCTTCGTCACGCCTCCTTTTGTCACACTAATAGTTAAGCTGTCGTGGTCACATTCAAGCCAAAA
CAGAGAGAACTAGCAAAAGTATAACACAACAATGTTAACTTTGCACCATCGCGTAAGGCATCCAAACAGAGAATGTTAACTTACACTGATCAAAACACCG
GCTTGATTCTGCGGCGTGATTGTCCATGTCTCGCTATCCAAGTTTTTATAGTCGTGCCAGTGAATGTGACCTTTGTTACCCACGCAGTCGAAGCCACTTG
ATACTGGGGTCATGGCAGTAAATGTTGTGGTTTCACTTAGAGCGCTGATAGAACCGTCAAATCTGATGACTTGGACTTGATAAATGTACGTTTTGCCCAA
CACAATTTCATCCTCGTACGTAATATCTTCTCCATTGTCAACGTAGAATTCTCCATCACGGAAAAGACGATAGCTGACCGCATCATCTTCAGCCTCCCAA
AAAACGTTAGCCACTTTGCGTGAATCTACAAAAAATTAACAGTACAGCCAAAGTTACAAAAAAGTAGTATTCTCAGTGAAATATTGTTCTTACGGCAGCC
AACTTGTGGCGGTGAAGGCTGATGGGCATAGAGCGGTGTCCTGAAGAAGATAATCTTGCTCGCTTCTCCTGATTCTCCAGCACCAGTGACTGCTCTCTGT
AACATACCGTAACATCAGTTAGCAAGCTGGATTAAACAAATATCTTGACAAATACGTACCACCGTGGCAGTGTATTCAGTCTGGGGTGTTAAATTCTCGA
TAGTTAGGATCTGTTCATCAACTGGGGTGATACCAGAAAATGTAACGCTGGGGTTTGATATCTGTACGATATTCAATCGATAGGTGTCAACGTAGCCTCC
TCCAAAGTCGATGCATGGATCCCAGTGAATAGTGACGGAAGTATTCGACAGCTCGGCGACGTGAACATCTTGAGGAGCTAGTGGAAGTGAAGTCGGCTCA
GTAGTGAACGTAACCTCTTCGCTAGGTGGTGACACACCGACAGTATTGTAAGCGAATATTGTCACTGTGTAGTCCGTAATTGAAAGTAGATCTCCAACCG
TGCAAGTACGAATCATGCCCTCGCAGCTCCCAACTTCCTCGCCCAGTCTTGCCATACTAAGATGGTAGGATGTTAAGGGGACTCCACCCGTGTCAACTGG
ATCTGTCCAAGATAGAGTAAGTGCACCACCAGTAGCTAAGGTAATAGTTGGTGGATCAGGAGCACCTGGAACAGTAGCCACCGACGTCGCTGTGGCAATA
CCGTTAGTGGTGTCACTAACTCCGACATCATTTGATATTTGGATTGTGAATGAATAAGCGGTAGACGGGAGAAGTCCTCCAGCTTGTAAATAGATAAAAC
CTCCACCATCTGCAGCCACTTCCATCGTTGCCAAGCGTCGAGTTCTTGAGACGGTAATCGGCATATTCTGTAGTCGACGTACTGCATCTACTGGGACTTT
AAACCCGTTCTCGTACACAGTACACACCAAGTCGTCAATGTTAACACCTCCAGTATCATTTGGGACTTGTATTGCCAACGTAGCAGAACCCCCAGACGAT
TGAAGGACAACCGGATCGCCTGGCAGTGAGGGTGGCGTAGGTAAAGTAGTTGAAAATCTTTTGACGCTAGCGTCGGATCCTATTCCCAAACTGTTTCCAG
CAAACACCTTGAATTCGTACACACGATTTGCTAGTAGTCCACCGAAGCTTATTTCAGGTAGAAGTGACTCTAATGCCAGTTCAGGATTCCCACTCGTATC
CTGTGCGTGAATAGAGTAGTAAGTGATCGGGCTTCCACCGTCATCATCGGGGCTTTTCCACGAAAATTTTATCATACCACCCGACGCGTTTATCAGTGTC
AAGTCGCCCGGAGGACCTGGCGCCGAGATGAGGGTTGTTCGTAGTGGATAAATAGACGAGTTACTAGAGTATCCAACTTTGTTCATGCAAGAAGCCATGA
ACAAATATTCCGTTACTTTCTGCAGCTTTGTTTGCCAATAGCTGATGTCCTTGTCGTTGTATATCCGCGTCCAAATTGGGATCGACCTACTTAGACTCAT
GTATATCTGGTAAGTCAGATTCTGATCACTTCCCCTGTCATTCGGAGGTTTTACTTCCACGTGAATCCCGCCACCGGTGGCACCTGTTGATCGTATCAGC
TGAATTGGCATTGGCTTCGAGGCCACATCTGTCGAATATATGACTTGCTTTGGAATATCTTCGTCATCCCCAGCACAAGCTGATGCGTCGTTCAGTGGGA
TATAGTAGAAGCTGTAATTGTTTTCGGGTACCAATCCACCAATCTCCACAGTAACTTTAAGTTCGAAGTCACCTTGCGATATGTAATGGTATAGCGTTCC
TTCCACCTAAGGGTCAAAGAAATGTTAGTTTTGAGAATAAAAAACGTAATGTCATTTCAGCAAATACTATACCGTTTTGTTATTGATGTAAAACTCGTAA
CCGGTGATAGGGATTCCACCTGATCAAGCAAAAGTATTAATTTCAAAACGGTACAACGAATTTCTGCACGTACGTACCAGTATCATCTGGCCAGGAAATG
CGTATATGAAGTGCACCACCTGTGGCATAGTCGAGATCGGGTTCTGGTGGCATTCCAGGTCGGGTAGGAGCCACTGTAGTATAGTTCGCCACATCGCTGT
AGGGCCCACGCACAAAAACGTCGTATTCGTCACCATTTTGCAGACTTGAGGCGGCTATAGCTCCAAAGTCGGTGCTTAATGACGCTGAATACGCGATGGT
GTTGTTAGATTGGACTTGTGTTGTGTCAACCTCGAACAAATAACCCTGTCAAGCAATTCGTGCGATAGTTAGCCATAGTGTACTTAATAAAATAAATTGT
AAAATAGATAAAAGCAGCACATACGCCAAAGTCGAAGTACCCGCTCTTTACAATCTCAGTCGCCACATTGTCCGATAGAGTGATCCGAGAATCGGAGACA
GAAATTCTACCCCAAGTAATTACGTTTGCAGAGTCTTCAAGGTGTGATACCGCTACCATATCGTAGGTAGTATCCGCCCCCAAACGGAAAATCGTGATCT
TCAAGCCATTCGCTACGTAGTAAGCTTGACGAAATCTCTCCCGAAGACCTTGTTTGCGGTAGTAAATCATGTACGAAATATTTTCATGTCCACCTGCCAG
TACGCTAAATTTTAGTTCGTGCGTACCTAAAATTATTGTGAACGTACCTGTGTCGAGCGGGGGCAAGAGGTCCAACTTTATTGCTCCACCTGTCCGCGAT
GATTGTATAGCGGGGAGTCGAGGTGGTCCAGGACGTGATAGTGGTCCACTTTCAAACGAAAAGGGCTCAGACATTTCACCAACTCCGACAACATTAATGG
CCTGTAGCACGAACAAACTGTCAGATATGAATACTCCCACCGAGTACCAGTTGATATCTGTCAAACATGCCTGAGCACGTATGATGTATGCAGTATTGGG
CTTGGTCACGCTAACTGGTATTATCGATGATAGATGTCCAGTGCCATTATAAGCCATCTACACAAATAAAAGAATCAATATGATGGGGCCTTCGACACAG
CAATAGTTTTTCATCATACCTTGAAATCACTGCCTTGTTCCGCCAGATGTACCACGTATCCTGTTATAGACGCTCCCCCAGAGTCACTGGGAGGAGCAAC
CGCGACTGTGAGTAAGCCACCCGTGCGATTCAGTAATGCAATATGTTCAGGTGGTCCTGGTGCTGTTAATTTTGTCGTAGAAAAGGTGACACTTGAACTG
TCGACTCCACGTCCAATGCTGTTGATAGCTGAAATGCTGAAGTTGTATTCCGTAAGCACATTTAACCCTCCGAACGGTATTACCGTAGCATTAGTAGGCG
TAATTATCCAAGTTGTACCTTTGACAGTACGAATAGAAACGTTGTATCCAGTAATCCAGACGTTTTGTCCGCCAACATTCACTGGAGGTTCCCACTTCAA
TCTCAACATCCCTCCTGTCGCTTTGTCAAGTGTTGGAGCTTTCATCGCTCCTGGCATAGAACGATCACCGTCATCCTGTACCACCACTTTAATCACGTTA
TTTGTCCCTATTCTGGCCGCGCCTGCTGCAATTTCTAGCGTAAGGTAGAAGCACAAGTACGGGAAATCATATACGTCGTTGTCTTTGATCACAATACTCG
CAGATGAAGACGTCTGACCATCAACGAAGTCCACAGTTGTGGATGGTAATCGAAACCCAATGTCAGGTTGAGTTGTGCTGGTCAGACCAGTATACACAAG
TATTTGGACGCTCACTGCTGTACTCTTTCCGTATTCTCGCTGCAATGGTAGACTTACAATTCGAGCATTCTCCAAGACGGTCACCTCAGTCACTACAAAG
CTGATCATTCCGGCATCCCCGTCGTCCACAATTATGACTATTATAGGTGTAGGCGGGAATGGGTCGGAGCGATCCGGGGTTGTGTCAGTGAGTGTTAAAC
CTATTGTCCGCGGGATCGGCTCATAGATATCATTATTGATGATTTGAACGTCAAAGCTCTTTTCTATGAGCTCCCCAACAAACGTGAAAGAGTGTTCAGA
ATCTGGTGGTAAACTATAGTCTCGACCATAGATAGCAGTGCCTGAAGTATTGGAATACTTGCAAGTAATTGTACTTGAAGACCCGTTTACACGAAGCAAT
TGTACAGTCACACTCGTAACATTTTCAAACACAGTCGATGATGCCAGTTTGTACGTGATAACACCGCGTTGTGTAACATCTGTTTGAGCTGGTAGATCTG
ATGTCCAATCACTCGTTCCCGCCGAGTTTCGAGCCCGAACTCGAAACAAATAGTCATTCCCTGGAATTAGTTTTGAGACCTCGACTGCTGTAGTGTTCGT
CTCCACTTGACCGGGTTCCGACGTGTTTAAATTATTAAAAGCGATCTCATAGACGACATCGTCGCCTCCCTTATCATCTGATTTGTCCCACTCAAAGAAT
ACTGAAAATGCCGTTCGCAGCACCACCCGAAGATTATTT