Description :
From Genome Similarity Track
Location :
Scaffold_18:17965- 33016
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_18-fgenesh-gene-0.12Gene of unknown function
Pytar_ATCC12531snap-par_contig_18-abinit-gene-0.79Cullin-associated NEDD8-dissociated protein
Pytar_ATCC12531maker-par_contig_18-fgenesh-gene-0.13Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_18-fgenesh-gene-0.4Serine/threonine-protein phosphatase
Pytar_ATCC12531maker-par_contig_18-fgenesh-gene-0.14ATP-binding cassette sub-family F member 2
Pytar_ATCC12531maker-par_contig_18-snap-gene-0.35Charged multivesicular body protein 5
Pytar_ATCC12531maker-par_contig_18-snap-gene-0.25ADP-ribosylation factor 2
Pytar_ATCC12531maker-par_contig_18-snap-gene-0.26O-phosphoseryl-tRNA(Sec) selenium transferase

Sequence
15051 bases(100 bases per row)
GGCCTGCACGTTGCAGGTCATCTCTTCAAACTCCCGAATCACTTTGGCCATCTGGGACTTCATGGCATCGAGCACATCGGTGCGAGTCTTGAGCTGGCGG
TCGATCTCGCCAGCCACGAGGTCCGTGAGCTGTTCAAGCTCCAGGTTGTCGTCCCCTGCTCCACATGAACAAGAGTCAGCTCCCCACACATGATCCCCCA
CATGTGTCTGATACACANNNNNNNNNNATTGTCGTCCCCTGCTCCTCATGAACAAGAGTCAGCTCCACACTCATGATCCCCACATGTGTCTGATACACAC
CCATAGCGAGATAGTACTCTTGCGTGTCGTCGCGTTGCTTTCACTTGGTCTATTTGCCGACGCGCGCGGCGCATCCGCTTTCTCTCGCTGCCCCATTTTC
CACCCATCCAAGAATAGTGCCGATAATGACCACATTGAAGTCACTCGAGCGAGTTTAATCCTATTCTAGTGTGTCCCACACCATATCTCAACCTCCACCC
ACGCCGTCCTGGTTTCCAGATCCAACCCACCCGCCCCACTCGGCGAATATCCCGCTTGAAGAGAGAACACCAAGACCGGAGGGAAACGCGGCGACGATGG
CGGGCCAGGACCAGCGCATTTCGCTCCTGCTGGACAAGGTGAGTAGCTCACGAGAGAGAGCGTGGCGCGGCGCGTCGATTGATCTAACTCTCGGTTTCTC
TAACGGCTGTGGCGGGCGGCAGACCACCGACTATGACAAGGACGAGCGCTACATGGCGACCTCGGATCTCTGCAACGAACTCAACAACAACATCGAGCTC
GGCGCGTACCTCGAGACCAAGTACGTACTGCTTCTCACCGTGCTGACGAATTGGTATCTCACGCTGAGTTCATAGGGTCTGTGCGGCCGTGCTCAAGCAG
CTCGATGACAAGTCGAACGACGTGCAGTCGATCGCCGTCAAGTGGTGCGTGCATCTTTTCTGGGGGAACGTTGATAGAGTCTCCCAATGGCTCACGTTCT
GGACTTTTTGTCTCTGATAGCATTGGCATCCTGGTCACGAAAGTGCAGGACACGCAGGTCGCCGATATCTGCAAGAAGCTCAGCGAACTGATTCTCAACG
GCAAGCCCGAGTTGCGTGACATCTACGCGATCGGTCTCAAGACCATCTTGGCCGACGTATCGCCCAAGACGGGCGCATTCGTGGCGACGAATTTGTGCGA
GCGCCTGGTCGCGGGCATCGCCAAGGATGCCGAGACGGGCGTCAAGTCCGAGACACTGGATATCCTCACGGATCTGCTGCGTCGCTTTGGCCACGCGTGT
GCTACCGAGCACGAGCAAATCATGAACCTGCTCGTCGTGCAGCTCACGGACGCGTCACCACTCGTGCGCAAGCGTGCGACGGCCTGCGTGGGCTCGCTCG
GTGTGATGGCCTCGGACCCACTGCTCACGCGGCTCATCGACCACCTGATCAAGGGCATTCAGACCAAAACGGACTCGGCCGACAAGCGCACGCTCATCCA
AACAGTCGGCACGCTGTCACGGTCGGCAGGCCACCGTCTCGGCAACCACTTGGACGCGATCATTCCGATTCTCGCCGACTTTTGCGGCGACCCCGAGGAC
GAGGCCATGCAAAACGAATCGTCGGACGAATTGCGCGAAAACTGCTTCCAGGCGTTTGAGAGCTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGACCCGATGGAC
GGCGACGATGACGAGGACTATAGTGATGCTGACGATGGCGATGACTACAGCGATGATGACGATACGAGCTGGAAGGTCCGTCGTGCGGCGCTGCGTGTGA
TTGCGGCGCTCATCACGACCCGTGAGGAACTGCTCGAGCAGTTGTACACGACGACGAGCCCGTTGCTCATCTCGCGTTTCAAGGAGCGTGAGGAAAACGT
GCGTGTCGATGTGTTCACTGTGTTCGCCGAGTTGCTTGGAGCGACACGCAAGGCCTTGCCCACCGATGGTCACCCACCATCCCAGGCCATTTCCACGTGT
CTGGAGAAACTCAAGCAGCGCACGAAGGCGATCGTGCTCGCTGCCAACAAACAGTTTGGCCCCAAAGCCTCTGTGGCTTCCCGGTGTGCTGTGCTTGCCC
TCCTCACCGAGCTCACGCTCGTGTTGCGCGGTGAGTTGGGCGAGTACGTCGATGTGCTGATGCCCAACCTGGTTCGGGCGGCAGAGGACAAGCACTCGGA
TCTGAAGCTAGAAACGATGATCTACTTGCGTCTTCTCATCGACACGCACAAAGCCGAGCCATTTGTGAAGCACATGTCGACGCTTGTAGGTGTTTCACTG
AAGGCTGTGAGCGGCGACTGGTACAAGACCGTGGCGAAGGCTCTTGGACTGATTGAATCACTTGTGTTCGTCCTCCGCCCCGACGCGGGCGGCGAACCGT
CGCTGGCCAAGCAGCATGCTATTCCACTTTTCGACGGTGTGCTTCCCAGCCTGAAGGCACACGACATCGACCAAGAGATAAAGGAAGCAGTTATCAGCTG
TGCTGGCCAGTTGGTCGCCCGCGCCGGTGATGAACTTGGTGCTCGCGTCAATGAAGTGTTCCCCGTTCTCATGGAGCGTTTGAACAACGAGATCACGCGC
GTCCAGAGCATGAAGGCGATTGCAGTGATCGCGCGTTCGCCACTCGCCATTGACTTGAGCCCGATTCTTGCTGATGTGACGTCCACGCTTTCTCAGTTGC
TGCGTCAGCAGTCGCGTACACTCAAGCAAGCGACCCTCGACGCACTCAACGATATTGTCGTGCACCATGGCAAGTCCATCAAGCCCGAGCTGTTGGCCGA
AGTTGTGACGGACGCATCGGCTTTGCTTGTTGACAGCGATATGCAGCTGTGCCGGCTGGGCATCACGCTCATTTCTAACGTGCTCAAGGCCAACCCGAGC
GTGGTCAATACGCCCGCGGTGCAGCAGAATGTGGTTACGAACGTACTTGCGCTTGCCCAGAGTGCGATGATTCAGGGCGCGACGCTCACTGCACTGAAGG
AGTTCTTTGGACAGTTGACGCAGCTATCTGGCTTTGGCGCGCTGTTTGCAGCGCTCACGACACCATCTCCGGATCTCTCGCGACAGGCGACAGTGAACGT
TGCGCGCTGCGTTGCATCGGTTTGCTTCGCCGCTACGGACGATGATCGCCACAGCGCTTTCACTAAGTTTGTCGCGGAAATCCAGCAGCCCAGCTCCGAG
AAGAACCGAATCCTGGCGCTTTACTGCCTCGGTGAATTTGGCCGTGTAATCTCGATTACGGACAACAACTATGCAGATGTCAAGCCAGTCATCCTTGAAA
ACTTCAACTCGTCGGCGGAGGATGTCAAGTCGGCGGCCGCGTACGCATTGGGCAGCATCTGCGTGGGCAACAAGGCGGAGTACCTGGAGACTATTGTCCG
AGGTTTGGAGCAGGGGGAGAACTCGTATCTGCTTTTGACAGCACTGCGCGAAGTGATCTCTCATCATGGTATCAGCGTCGACGATGGCTTTTCGGCCTAC
ATTGACCGCGTCTTGCCTGTGCTCCAGACGCTGAGCGAGCGTGAGGAAGAAGGTGTGCGCAATCTCGTGGCTGCGTGTCTGGCCAAACTGGCGGTGACGG
ACTCGACTAAACTGGTTCCGGTGATTCTGGAGTTGACGGTGTCCCAGTCCGTCCACTCACGATGGACAGGAGTGACAAGTATCAAGAACGCTGTGACAGC
CGCGACGACAAGCGGCAGCACTGATGTTGTTCGTGCGCTGTTCGCTGACGTAACTCCGTTTGTGAAGACTCTTGAGGACGAGGACGTCAACGTTCGCCGC
GCTGCCCTGCTCGCCCTGAACACGTCGGCCCACCATCAGTCCACGTTCCTTGCGCCGCACATGAAGGACAAGATTTTCCCGGTCCTCCTCAAGGCTGCTG
AAGTCAAGATGGAGCGCGTCGTGGATCTTGGTCCATTCAAGCACAAGGTGGATGATGCCCTGCCATTGCGTAAGGCAGCCTACGCCTGTGCCGACACGCT
CTTGGACGTGCTCCCACAGCATCTTGAAGTCGCTGCTTTCTTCCCGTACTTGCAGCTTGGCCTCAAGGACCATGATGATGTGCAAACGCTCTGCCACCAG
ATTGTGATCAAGATCTGCGTGATCAAACCAGGTGTGGTCGTGGGGTCGCTCGATATGGTCCTCGAGCCGCTGGAAAAGACAGTCAACAAGAAGATCAAGG
AAGATCAGGTGGGGACAGAAGTGGAGCGTGCCAAGGACCTGATCCGCAGCGGCCTGCGCGTCGTGGAGGCACTCAGTCAGGTGCGTGACACGGACACGCA
CCCCAAGTTCCACTCGTTCCACGAGAGCGTCAAGAAGAACGCGTCGCTCGCAAAGCTGCTCGAGGAAGTCAAGAGCGAGTGAAAAGGTGAAAATCGTATC
ACTGGGAGGGCTCCCTCTTTTACAAGTGAAATCCGCACTTTCTTTTTTTACAGCCCATCGTGCATCGGTTTCTGGGCATGGGTCTTNNNNNNNNNNTGAA
ATCCGCACTTGCTTTTTTTTACAGCCCATCGTGCGTCGGTTTCTGGGCATGGGTCTTCTTCTTCTTGATCTTGTGGTTGCTTTTCTTGTCAGGCTTTGTT
TTCTTGCGCGTCAACGTGGGTGGCACGGGTGGGTCCACACTCTCGATGGCGTCGTCGCGACTGTACGTCTTGCTGTTCCAGTCGTAGGTCACGACCTCGC
GCTGCTCGTGGAGAAAGAGCCGCAGCTCCTTCAGGAACAGACCCTTTTGAAGACCTATGAGCACCTTGGCGGTCTCAATCTCGTAGATGGTGACGTCGAC
ACCGCCGTTCCAGAGCATCTGCCAGTGCCATGTGAGGAGAGCACGTTTCGATTCCGACGGCAGCCCCACGCACCTCTTTCCATCGACTGGCCAGCTCACT
CAGCGGCTCGTGGGTCTGCAGCGTTACAAACACCATCTGCGGACCCATGGCCTTGGCCTGCGGTGGCGACCTGAAGCGCATCGCAGCAACACCACACTGC
CATCAGCAGAAGAACCAATCTCTGCCGATCCACAAGCACCTCTCTGACATGGCGCTGAGTCTGTCATACTGGTCGTCGGCACCGGAGCGCCGTTCCGCCG
GTGCGTCGTCAGCCTCCCACGCCTTCTCCAGCGCGTCCCAATCGATCTCTTTGCGACTTGCAGCCGTTGCCACGGCCACCACGACCAGCAGCAAGAGCGA
GAGCGACGGGAGGTGCGTCCGGATCCGCATGGTCATCACCATGAGCTGGTATTCCGATTTTTCTCTGGACGCGGGATCATCAAGTCGGATTTTCAGCCAA
TCAATAGGGTTTATTCTATTATTGACCAATCAAATGTCCAGTAGCGCGACCTTTCACCAGCTATTTTGGAAAGATCGGGTGAACCCATCTAAAACGGGAT
CATGACCGCTGCTCGCTCTCGCTACTTCGGCCAGCAATGACCACGCGCAAGGCCACTGCACGACGCTCCGCAGAGAGCGACTGTGGGCCAGGGCGGCTGT
CATGAGCCTCACGCTGTCGGCAAATGCTGAGCCCGTCAGTGAGGATCGCACGCAGCAGCAGGAAGAGGACGAGGACGCCGTCAGCGCCGTCAGCGGCCGT
TTGCTGCAGTCGCCAGCAGCGGCACTACCGCGTGAACTCTTCACACTGCAGCTCCGAAGCGATGGTTTGGGTGTGAGCCCCGACCGAGAGCGGCGCGGGC
AGGCGTCGCCGTCGTTTGACCAGCTCAAGTCTCCGATGCTCGGCACGGAGACGAGCCCATTCAAGCAGCTCCACCTACAGATCCAGGTAAGACAGGGAAT
ACCCCCTGAGGACTTCAGACGATGTTGCGATTAACGCGCATGTTGCTATCAGAAACTCAAAGAGGCGCTTCAAGTCATGCGCGTCGAGAAAGACACCGAG
ATCGCCTTCTTGCGCGAGCAGCTCGCACGGTCTCAGGTGACGCAACGAGACGCTGACGAGTCGAGCACCAGCATCAGCACTACCACCAGCAGTGGTGTAC
CCCCATCCAGCCACAGTAATACTGGACCTGCCCGTCCACAGCTTGTGCCGTGGATGCACTCGATCTCCGAGCGTGGGGACATCCAGACGAGCCGCCTCGG
TCGCCACGCGAGTCTCAAGTCGGTCCGCGTTCTCGCCGACCTGCAGACACAACAACAGCAGACCCACGACGCTCGCGCCGGCGTCGCTCTCGCTGAGCGC
ATAGCTGCAGCCTTTCTGAACCCGGTGCTTTCGCTCCCGTACTTGCACTCGATCCAGTTTGGCGCCGACCTCGTCGAGCTCAGCGCCCACGTGGGCGCGC
TACTGGAATCCGAATCGCGCTGTCTCTCGCTCGCGAGTCCCGTCTACGTTTTTGGCGATCTCCACGGCAACTGGAGCGACCTCTCGTTCTTTGCGCAGCA
CTTTTGGCGCTTTGGCTTTGGGCTTTCGGCCGGCACATTCCTCTTCTTGGGCGACTACGTCGACCGCGGCGCGTCGTCACTCGAGTGCGTCGCCTACCTC
TTCGCCCACAAGCTGCTGCACCCGCACAAGGTGTTTCTACTGCGTGGCAACCACGAGACGCGCGCTGTGAACGGGCTGGAACACTACTACGGCAGCGGCT
GCTTCCTCTCGCAGTGCCGCGCTCGCTTCGGGCGCGACGAGGGCGCGGTCGTGTGGCACCAGATCAACCACGCGTTCGATCGCCTGCCGCTGGCCGCGAC
CATTGACGACCGCGTCTTTTGCGTCCACGGGGGCATCCCCCGTGGCCTCGTGGGGAGCGAGTCGCGTCTCACGTCGATCCGCCGGCTGCCGGCCACGGCG
CCCATGGACGCGCTCGACAAGAAAGTCTACGACGCCAACCCGCACTTGCGCATGGTCAGCGATCTGCTCTGGGGCGATCCGGCCCGCGAGGAACACGAGT
CGGCCCTGGACCCCGTATCGGGCTTTGGGCCCAGCGTGCTGCGCGGCGGCAGCGCTGTGAGCTTTGGCGACCGCGCCATTGCCGCCTTTCTCGAGACGCA
CGGCATGACCCACATTCTCCGCGCCCACGAGGCCCATGTGGACGGTGTCGCCGTGGCCAAGAGCGCACGGGTCGTGACGATTTTCTCGACGTCGAAAGAC
CACGCACTCGGAGAGGACGCCACGTGCGGCTGCGTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGG
ACAAGGACCGCATCGCCGCGATCAATCGGTCCGCGGCCACGTGGCCGCTGACGCTGAGAAGGAGACGCAGCGTCACGAGCCTGCTTCCACCGGGGCCGTT
AACGCCGAGAACCGTGACACGTGGGGCATCAGCGTCTGCTGCGAGTGCCCCGAGGGAAGAGGCGGAGGAAGCTCGTCGTCCAGCGGCAGCCGCTAGCTCT
TTCTCAGCCTCAAACGCGACGGCCACGTCGGCTCGCCGGCGTGCCCCCCACCGTGACGCGTGTGCATCGACGACGCTGGCACCACCCCTGTCGTCTGCGG
TCCTTGCCACGGCCCATGACGAGTCGGACTCGACCGACGACGAGGCGCCGAACGCGCGAGCGAACGGCCCCACGAGTAGCTCTGCTAGTAGTAGAGGTCG
TGGCTTGCCAGGCGATGACAGCAACCAGTCGGAAAACTAATACACACACACACACACAAGGGATCACTAGTCTTTTGTTTGACTCGGGGTTATCTATGAT
AATGCAGACCATGCAAAGCAGCCAGGGACGGCGAGGGCGGGGGCTTGGCGTTCACTCCCCACTACTGCGTGCGTACTTAAGCCGCCGGCTTCTTGGGCTC
GAGCTTGAGCTGCTTGCGCACCTTCATCTTGAAGTCGCTGATCTCGCCTTCGTAGACGCGGATCTTCTGGTTCTCGACGAGCCAAATCTCCTTGGCGACC
TGCGAGATGAGCCGCATGTCGTGCGAGACCAAGAGCATGCCGCCCTTGAAGTTGTTGATGGCGCGCGCCAACGCGTCGATCGACTCCATGTCCAAGTGGT
TCGTCGGCTCGTCCAGCAGCAGCATGTGCGCGTTCTGCTGGGCCATGTAGGCAAACACGACGCGGCTCTTCTGGCCGTCCGACAATTGGCCCATGATCTG
CGTCTGCACTTCGCCGGAAATGCCGTACCGCCCCAAGTACGACCGCACGTCCTCGACTGACTTGCCCGGCAGCAGCGACCGGAAGTAGTCGAGCGGGTTC
ATCGTGAGGTCGAGCACGTCCACAAAGTGCTGGCTAAAGCGCGCGACGCGGAGCTTCGTGTGGGGCCGCACGTTGCCCTCCACGGGCACAATGTCGTTCG
TGATGAGCTTGAGCAGCGTCGTCTTGCCCGTGCCGTTGGCGCCGACCAGCGCCACGCGCGAGTCGAGGTCCAGTCCCAACTCGACGCCCGTGTACAGCAG
CGGCTGGCCCGGGTACCCAAACGCCACGTTCTGGAACATGAGCACGGGCGGCGGCAGTCGCTCCGGGTCGGGGAACTTGAAATCGCCCACCGACTCGCTC
TGCACCTTTTCCGTGAGGCCCTCGCGCACCATCTTGGCGAGCGTCTTCTCTTTACTCTGCGCCTGGCGCGCGAGCTTGGCCGAGCCGTGGCCGAAGCGTG
CAATGTACTCCTTCATGTGCTTGATCTGGTCCTGCTCCCACTGGTACTTCTTCATCTGGTTCTCTTCGCGCTCTTCCTTGGTCTTGACGTACGTGTCGTA
GTTGCCCGTGTAGTACTCGAGCTTGTGCTGCGTGAGGTCGATAATGTTGGTGCACACTTCGTTCATGAACTCTTGCGAGTGCGAAATCATGAGCAAAATC
TTTTTCCACTTGGACAGGTAGTCTTCGAGCCACACAACGGCCTCCATGTCCAAGTGGTTCGTCGGCTCGTCCAGCAGCAGCAGCGTCGGCTGGATGAACA
GCGCGCGCGCCAGCGCAATGCGCATGCGCCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATCATGGCGTC
GGAAAAAGTCAGACCCGACAGGATCGCGCGCGCGCGCAGCTCGGCCGTGTCGGCGTCCATCTCTTCGAGCCGCTCGTAGATGTCCGTGAGCCGCTCCGAG
ATGGCCGACGACGCGTCCTCGCTCAGCGACTCGTCGAGCATCTGCTCCGAGAGCTCGTCGGCCTCGGCCTGGAGCTTGTTGCGCTCCTCGTCCACGGCCA
GCACGGCCTCGAGCGCCGTCATGTCGCTCGCCTCGATCTCGTGCTTGAGGTGGTAGATGTCGATCGAGTCGGGGATGGGCACGCCGCGCGCGCCCAGCAC
GTTCATAAAGGTCGACTTGCCCGAGCCGTTGCGGCCGATGAGGCCGTAGCGCCGGCCGTAGTTGAGCGAGATGGTCGTGTCCTCGATGAGCTTCTTGCCG
TGGAAGAGCAGCGAGAAGTTCTCGACGTTGATGTCCTTGAAGTTCTTGTGCACGGCGCGCACCGACTGCGAGCACGTCGTGATGATGCCGTCCTCGGCGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCGGCGAGCGACATGCCCTCGAGCGCCAGGTCCTTCTCGGCCTTCTTCTTCTCGTCGGCC
GCGGCCTTGCGCAGATCCTTCTTGCTCACGCGCTCCTTCTTCTCCTTCTTCACGCGCGGCGCCATGGTGGTCGTAGAGAGGGGACGGGAGGGGAGCGAAG
GGGAGGGGACGCGGAGGGGAGAGGAGGAGGAGGGGATACTGCTGCTTCGCGCGAGATGCGATTCTTCTGCTGACGCAGGCGAAAGGCGAGATGGGGGAGT
TGGGCCTCCCCACCAACCAAGGATCCAACCAGAAGCGACCTCTTCAATTCCATACCCTGTTATTAACAAGGTGCTTAATCTTGACCCCGAGAAGTCAAGT
AAGATACAAACTGACAGTTGATATCCCATACCTGTACAAACCGTTCTACAAGGGATCGATTGGTGGATAATGGTCACATGGGTGCATCTGACCCCAAAAC
CAACGGGCAATGCGATCGAACTGAACCTGCAAATGGACTCACAGTGTAAACCGCCGCTCTGGCGGGTGTTACAAGCCCACGGGGAGGCCAAAGGCGTCCA
CGCGGCGTGGCTCTTGGCGCTCGGGAACTCCCGACGGCGCCGCCGGCATCTCGTGGGTCGTGGGCGCGAGGTACGACGGCGTGGCCTCGGCGGCCGCGGC
TGTCGCTTCTTCCTCGGCCCACTCGTCCTCCAGTCCGAGGAGCTCAGCCTCGAGTTCGCTCTCGTCAATGTCGGTGCCGAGTCTGTAGTCAGTAGAAAGA
ACGAACGGTGAGGAGGCCATCCACACGAGCACGAGCACAGCGAAGAGACGGACCCGTAGGATCGACCCATGATCTCCTGGATCTCGTTCATATCTTCCAT
CATGTCGGCCAGATCGTCTTGCATGTCCTGTGGGGGAAGCACCCTTCAGCACTTTACGGTATCCCATGGAGTAGGCTATAGCACAGCGCCCGCACCTCCA
GATCATTCAGATCGATCTTTTTGGTCTCGACCTTGAGCTGCGCCGCTGCGCTCTTCATCGCCGACACGGTCGAGATCGTGTCTTTCGTCGATTCAATCGC
AAACGACGCCTACCAAACACCACAGCACCCATCGCGTCAGTGCTGCTGCTACCTCAAAACCCATTCACTCTTAAACCAGTCATGCGGACCTGCTCCAAGT
TGAACGACTGCGCCGCGAGGTTGTCGCGCTGCGCCTCGTACATCTTCTTGCGCTTGAGCACACCCACGGCGCGCTGCTTGAGTCCGTTGAGCGCCGGTCC
TTTCGCCTTGGCCATCTGTAGCACACATTCCACCGTGAATGGGACGCACTATCATTGAGAGGGCACTCATGATTTTAGAGAGCTCACCTGCACGCGGAAC
TTGCGTAGCTCCTCATCGAGCTTGGCGATCTGTCCAGTCGCAAGTCAGCAAATGGCTCATCTTGTTTCGTTGGCTTCGTGCAGCGTCCAAACCTTCATGT
CCAGATCCGTGACGCGCCCATCGACCTTGGCGTTGACGTCGCCAATGTTGACGGCCGGAGCCTCCGGCTTCTTGCGTCCGAATATCCGATTCATGCTCGC
GATCGCTGGTGAGCTCTTGCTCGTGAGCTTCTCGCTTTTCTTCTTTGTGTCGCACTCCTCAAACTCGGAATGATGGTGAGGTGGGTACGTAATAAATCAG
AGTAACCGGTAATTTACCACCAGAGGGTAACCCACTACAGATGATGACAAAGTGCGGTACATAAATGTGTAGATATCGAAAAAATGGTGTAACCACAGTA
ACCCTGGGCTCAGTCGGAGCTTTTCGATGCTCGCCGCAGCATGCCGTAGATGCCGCCGTGCTGAAGCTTCGCAATGGACGGTGGAGACGCCTTCTGTCGC
CACCCAAGATTCGTCAGTCAGACTTTTGGCGTGACATGGGTGCATTTTTTCAGTCATGAACCCACCTTGCTGACGGAGAAAACCCCTGGTGATACTGTGC
ACCAGCAGTGATAGTACCTTTCACTCCTCGGCCCCCCACGACTGAAAACACATCACAACAGACGCACCTTCGGGTNNNNNNNNNNCTTAGTACCTTTCAC
GCCTCGGCCCCCCCACGATTGAAAACACAACACAACAGACGCACCTTCGGGTCCATGCGGACTTCGTTTCTCACAAACGAGTGTGGGCTCGTGTTCAAGC
GGTTTGTTCTTGAGCAGCAGTGAGTAGATGCCGCCATGGCGAGCCTTGGGCTTCATCTCAGTCTTTCCATGAGACAGATTCGGAGACCGTCCGCTCCCGT
GAGCTGTTCGTCGATTCACTGTGGATGGGCTGGAGCGTACGCTAGTATTAGAGCGCACAGCGGCTGACACAGCTGAATCTGTCGTGGCTTCATCCGCAAT
GTTGTCGTCCTGTTCCTCAAGCTCAATGAAAATCTCGCTTTCGCTTCCCCACAGCGAATGGCTCTGTGGACTCTCAGGAAGTGCCACGGGCGAGGCCAGA
TCCAGCTCATTGCCGTGGGCCGAGTGTGCGGGCGACGCTTGGAAAGGCATCATGTGCTGCGTGGGCGACGTCAGGTCAATAGCCTCTTGAGACAATGTCT
GGTTATGACCTATGAGGATAAATCAAGTTCGACTAATGATTTGACTTGATCGCAGCAGGCAGCATATACCTCTATACCTGAGTACTCGTTCAAACCCACT
CCGGCCAGCACTGAGAGCCGCTTGGCACAGTCCTGATAACCTTCTTTGGCCTCTGTATCGGAGTCTTTATCATCGTCATCGTCTTCCCATTGCTGCGTCG
TGCCGTGTGGGCTGAGTAATGCCTGAAGTGTGGAGTGTAGCCATGTCACGATAAGAGTGAGATATATGGTTGGGGACACAAAGACTAACGAGAAAGTTGC
TCGCTTATTCACTCACCAGCAACTCCAGCGACATGCCCGCATAGTCTTCCGNNNNNNNNNNAACTAACGAGAAAGTTGCTCACTTCTTCACTCACCAGCA
ACTCCAGTGACATGCCCGCATAGTCTTCCGTGACTTGTTGATTGTCCTCGTCACCTCTCGTCTGTTCAGGGGCAGGATCCAACGCCATAAACCGGTCGAG
CGGAGGGCACCGCTCCGGTAGACGTAGAGTGCGCGTCGGTGGGGTCTCGTTCTGGTTCGCGCTCGCGCCGCCGCGATCACCACCACCTCGACGGGCACTC
AATGCATTGCTGTGGTGCTTGGTCATGCTCTCAGATTGAAGTGGCGAGCACCACTGATGAACGGATTCTCTATCTTCTCTTCCACGAAACGTCACAAAAG
CTGTTCTCAGACTCAGACGAATGAATCAGATATCGCTTCAGATGCCATCTTGAGGTCGCGCTGGAGATCGCGAAACGATGGGGCTGCTGAGCATTCTCAA
GAAGGTCAAGGAGAAGGAGAAGGAGCTGCGCGTGCTCATGCTGTGCGTACAATAGAAGGAGACAGTGCATGGCTGTGGTGGGGCTGCTGACGCGTGGTTC
GGTTTATGGCGAAAGCGGGCTCGACAATGCCGGCAAGACGACAATCCTGAAGAAGTTTATGGGCCAGGACATCACCGAGATCTCTCCGACGCTGGGCTTT
GATATCCAGACGCTCGAATTCAAAGAGTGCGGAGTTGAGTTATACCCACTGTCGCAATGGACGATGTAAACGTGGTCTCATCGGTGTGTGATAGGTTCAA
GCTCAACGTGTGGGACGTCGGCGGCCAGCAGACCATCCGCTCGTACTGGCGAAACTACTTTGAACAGGTACGCTGGTCCGCCGTCCTGGCGTCTCTATTG
GTCTCGCTCTCGTGTTTTAATGTGGGCTCGTTCCTGTCGGGACAGACCGACGGCATTGTGTGGGTGGTGGACAGCGCCGACCGCCGGCGATTAGAGGACT
GCCGGCTCGAGTTGCGCAAGCTACTCGCCCAAGAGGTACTGGCTGCTTTGCACGCTGCCGCTATGATATACTCTGACATCCTGCGCCTCTGTCTAGAAAC
TCGCGGGCGCGACGCTGCTCATCTTCGCCAACAAGCAGGACCTCCCGGGCGCCCTCTCGTCGGTCGAGATCGCCGACGCTTTGGACCTGCGCTCGGAACA
GTTCTCCACGCGCCACTGGAGCATCCTCAGCTGCAGCGCGTTCACGGGCGACGGTCTCATGGACGGCGTCGACTGGCTCGTGGCCGACATCGCTAGCCGC
ATTTTCCTCATGGAGTAAGCGAAATGTACTGGAATAACACGTGAGATTATATACCCCATGGGGTACAATTCCAGTTCCCTGTGGAGCCGGTCAGCCTGAG
ATGAATGCCCGCAATGCCGAGCTCGCGGCGGCGCTCGTGCCGGCCGGGTACGTGCAGCAGGGCGTCGACGCGATCCGCAACCGAGAGGCCCTGTTGACCA
CGCTGCTCTCGCAGCGCCGCGTGCCCGACGAGCCGTGGGACGAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGCAGCAGCTCGCGGCCATGGA
CAGCAACAACTTCCGCACCAACATTGGCGCCGGCGAGCGCGAGGCCCGTGTCTTCTCGTCGCTCGTGGCTCAGCGCCATTTTTTCCTCTGCCACGGAGTC
GGTCGCTCCGGTGACGTCGCGGCCGTGCAGCCCAAGGCCGCCGGCTCGTCGTTGCTTGTGCAGCTCAGCAACGCGCTCGCGCGGGACATTTTACGGGACG
CTGGGCTGCGCCTCACAGCGGCCGCGGTCGTGCTACCCGTGGCCACGGGCATGTCGCTCACACTCGTACTACTGGCGCTCAAGACTCGAAAGCCAGAGGC
GACGTACGTCATCTGGCCGCGGATCGACCAAAAGTCGTGCCTCAAGTCGATCCTCTCGGCCGGGCTCACACCGCTGGTCGTCGAGAATGTGCTCGAAGAG
AGCGGCCAGCTACGCACCGACGTGGACGCCGTCCAGCAGCTATTTGACCAGCACGGCAGCGCAAGCGTGCTGGCAGTCATGACCACGACGAGCTGCTTTG
CGCCGCGCGGCATGGACCGGCTCGTCGAGATCGCGACGCTCTGTCGCGACTACGACGTCGCCCACGTCGTCAACAACGCCTACGGCGTGCAGTCGTCCAA
GTGCATGCACGCCGTGAACGAGGCCACGCGAGTCGCACGGGTCGACGCCGTCGTGCAGAGCCTCGACAAGAATTTCTTGATGCCCGTCGGCGGCGCCATT
GTGAGCTCGTCGAAAAAAGAGCTGGTCCACCAAGTCGCACAGGTGTACCCGGGGCGCGCGAGCAATTCGCCGAGCGTCGACTTCTTCATTACGATGCTGC
ACATGGGGCGCACGGCCTACCGGAAACTGCTTCGCGATCGGAAAGAGCTAGCAGTGTATCTCAAGACGCAACTCCAGCAGGTCGCGAGCGAGTGCGGTGA
GCGCGTCATCGAGTCGCCGCAGAATGAGGTGCGATCAATACTCGTGAGTCT