Description :
From Genome Similarity Track
Location :
Scaffold_127:17963- 20528
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_127-fgenesh-gene-0.4GM26228

Sequence
2565 bases(100 bases per row)
CCACCGCCCGTGAAGAAGGAAAAAGCGACCGCGCTGTACAATTTCATCCCCCAGGTGCGGATCTCAATGCGCAAAGCGAGTCTGAATGCTCGCATATGAG
GTTGAGTCATTGAACACACGTGTGCATGGTTTTAAACAGGACCCTCAAGTGCAAATCAAACTGACCAAGGGCGATGAGGTAGAAGTGGTTCGCAAGGACG
CCGACGGCTGGTGGTTTATTGAGAAAGACGACGACAAAGGGCTGGTGCCGGGCTCGTACTTGAAACTGCACCATCCTGTCATTACCAACATCCCGGACGC
AGCGATTTTGGCTGCGCGCGAAGCGTCAAACCAACGCCTAATGCGAATGTCGACGACGCGCACGTCGCTGAGCAGCTCTCGGGGGTCGGAAGATTCGTTG
CGACTGGATGGACTCTCGTTTGACGATCCGTCGAACCCGCAGGCGCCAAAGGGACCAGCGTCCGTGGACGCCAAGGCTAGCGACGTCGACCTGAAGCCCA
CGGTGCGCAAACTGCGCAAGTGCTTTGCGTGCAAAGAGACCATTCTCGGCAAAACGAAATCAGCCAAGGACGAGATTTTTCACGAAATCGTGAGTGTCAT
TCGTTCTCCATCGCGCTTAAATGATCAAATACTAATTTATAGCATGGATATCTGCTAGTGTCTACTGTGCCCTGGATGCCGCGCACAGATCGAGGAAGAC
GAAGACTTCACTGTGATCAAAAAGAAAGCGTTCCACGCAGATTGCGCGAAAGAAGTCAAGCATTGCCGCGTGTGCGACAAGGTACGAGCATTTTATTTTT
GTGTGTTATTGCGAGCTGTGCTTTGCGATTTGCAGCGTGCGTATTGATTCACGCTAACGGGTTTCGTTCGTTGTTTTTTTTACAACGTATTGCTTGCTTG
CATAGGAAATTCTTGGCCGCGTGTACAAAGCAGGTGACGGCTCGTTCCATCGACTCTGTATGGTCTGCTCTCAGTGCAACCAGCAGGCAGACGAAGGTTG
GTACTGAAGCCTGTCAATCGTTCGGTTGATTAGCGAAAGGACTATTATTCATCACAAAATAATTTTCACTTGCTTGGCAGGTGCCAAGTTTGAGGATGAA
GTGCTGGTTTGCAAGCCGTGCATTGAAGCGAAAGGTACACACGATAGTTTTGTGGATGATACAGCGGATTGTGGAAGCCACGGAGCTTATGATTTTTGTA
AATGCTTTGTGGCGCTACAGAGAAAAAAGAGCGAGAGGAGCGAGAGGCTAGAGAAGCCGCTGAGCGTGCTGCGGCAAAACTCAAGGCGGAGCAGGAAGCA
GCGGAGGCTGCCGCGCGTGCTTTGTTAGCGGAGAAAGAGCGTAAGATCGCTGAGGAGGCTGCCCGTGCGAAGAAAGAGCAAGATGAGCGTGAGGCGAAGG
CTGCGCAAGAAGCGGAAGAAGCGAGATTAGCGGAGGAAGCACGGCTAGCGAAAGAAGTGCAGGAAGCCGAAGCTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGTCGGTATGTTCGTGGAGCAAGCACCGCTAGCCTCGACCAATTTGATCTCGGTGCATTTTCGGGCGATACCGTGGGACAAGAACGGATGTCCGAG
ATTTCGGATTTTGGTTCGGAGTTCGGAAGTGACTACTCGTTCATGAACAACAACCGCGACTCGCTTCGTCTCTCNNNNNNNNNNNNNNNNNNNNNCGACC
TCGAAACAATCGATGGGCTCACCAACGGAGTAGGACGTGGAAGCCGAGGTAGCCGCGCTGACCGTCTTTCGACGTTGTCAGATTTCAGCACAGTGTCCGA
TCGCGCGTCGGAAGTGAAAACCGATCGACAAATGCATGCTCCCGTTCAGGAAGAGCAGGGCGGTTACTTGTCGGACGAAGACGGAGAGCAAGAAATGTGC
GGAGGCTGTGGGCGTGTTCTGGAAGGAGAGGCTATTGGAGCGTTGAACCGCTACTTCCACTACGAGGTGCGTCGAACGCGAGCTTATATGCATCTGTGCC
TTGTTTCCATTGCGCTGACACTAAACATTTTGTGTGTGGTATGGTTGTGGATGGCTTCATAGTGTTTCAAATGCAGTCACTGCCGCCGAGTTATCGCTGA
GGATGACGGATACGCCGAGAAAGACAACCAGGTACGAAGTGCACTGTTGCGCTTGAGCCAGCGCTTTCATGAATGTGTCTCAACGGCTGGTGGTGTTTGT
ATTGTGTCATGGTATAGGCTTTCCATCAACAATGCTACCAAAGCAAGTTTGGCAAGAAATGCTGCCGATGCACCCAGGTATGTCTTTTGTATCACGTTTC
GCTTGTGACGCAGGAAAGAGCAATCCTCACTCCGAGATGTGCTCGACGACAGACTCTGAAAGGAAAAGTGGTCAAGGCCCTTGATAATTTGTACCACCCA
GGCTGCTTCGTGTGCTTCCAATGCAGCTCGTCTCTCTCTGGTAAGCAGCCAAGTTGTTGGTGGAAACTCTGAAATTGTGCTGATTGTTTTTCTTTTCTTT
TTACGTATTGCAGAGAGTTTCTTTGAGCACGACGGCCAAGCTGTGTGCGCCAAGTGCAAGCACAA