Description :
From Genome Similarity Track
Location :
Scaffold_29:17955- 20535
Transcript NameFunction/comments
Hyaar_Emoy2804454hypothetical protein

Sequence
2580 bases(100 bases per row)
AGAGATAGTTAATCTCTTGAAGATGACGTGGGATCTGTTCCTGTCCGTACTAAAAGAAGGAAAGTTTTATGAGGATGTCGCACCATCTCCAAAGGAGAAC
TTGGTGGACTGTTTCTCTTCGTCCACAATAGATGAGAGTGTATTTGAGACCGACGAGACAAAACGATCCGCTGCTCAAGGCTGGAGCCTTAAAAAGCAGT
CCGTCTTACGAAGTTCTGTGGAAGCACCGTGATGCCTTTCCTACAGAATTGCCGAACTGCCTAACGGCTGATATGGGTATCCGGCACGGGATCGACTTGG
AACCTGGCACCAAGTATTGTGTGACCAGGAAGTGGCCATTGCCGAAGGAACAGATCGAATACGTTCTTCGACAAGAGAGCCAAGGGGGGGGACATTTACG
TGAGAGTAAGTCGCATCAATGCAGCCCGACCTTTTGTGTGCGTAAGGAAACAGGTGGATGGCGCGTAGCTCACCCTTACAATAAGTTGAGCTCGGCCACC
ATCCCTGCGCGGCCATCGATCCCGCGGAAAGATTTCCTATTGAGCTTAATGGGGAATCAACTATCTTTTCCGCATTGAATTTGAAGGATGTCTACTATTA
GGTACTCATAAATGAGACCGATGTAGCCAAGACGGCAGTTAGCACTCTGAGTGGTATGCTTGGGAATGACTAGTGATGCCGCAAGGGTTGAAAAACGCAC
CAGCGACATTCAATCATGTGGTCGCTCACGTGATGCGTCCACATAGTGCTTACGCGCCTCATTAATTTAACGATGTGTTCGTTCATAGTAAGGCAGAGTA
CGGTTTGAGCGAGACTGAGTCGCACAAACGTCATCTGGACGTTGTGTTGCAGACTCTGGGCGACGCCCAACTGTATGTCAGCTTGCAAAATTGCGTCAAA
GGGACCTCAAAATACCTGTACTGGTCTGCATCGTGTAAAAACACGGTGTCACAGCAGACCCAGAAAAGGTTAAAGCTATAAAGGAATGGCTAGTCCCAAG
ACGTGTGAAGGATCTGCGTCAATTCCTTGGGCTTACTCATTACTTGCAACAATACAGCAATAATTATGCAGAGCGAACCAAACCAATGTCTGACCTTCTA
AAAAAGGACGTCGAGTGGACTTGGTATAAAGCTCAAGTAGATGTTTTTACCTCAGTGAAGGAAATCACTTGTAGAGGCTCCGGTATTGGCTTTGCCGGAC
GCGGATAAGCCATTTTAGTGTTGTCTGCGATGCAAGTAAAAATAGCCGCCGGTAGTACATTTATGCAAAGAGATGGTGACGGCGTTGACCGTGTCATCTC
GTATCAGTCCCGGCTTTTACAGACCGAAGAGCTGAATTACCCCTTGCACGACAAGGAGAATACTTTTTATAAAGTATACTCTTGTTAAGTTTCGAGTGCA
CCTATTGGGCACCGAACCTTTTGTAGTCTACAAGGATCACGCATCACTGCGGATCGCGATAAACTCGCCGCACATTTCACCTAGGATGGCGAGATGGCTT
ACATTCTTCTCAGAATTTAAATTTCGAGTTGAATACAAGCCGAGGAAGTCGAATGCCTCGGCTGACGAGTTATCGCGCAGACCAGACTTCGAGGAACGAC
ACCTTGAAGACGTGTTTCGTGCTAAAGCACGAATTGAGTCGTCATACTGGCGGCCCTACGATTTGACCATGAAGGTTTGCACATGGTCAATGCAGGACGA
ACATTGTCGTCTGCCTATAGATCACTTCGGTGGACGAAAAGTTACTCTTCCGTCGCAACTCAAGACTAAGCTTAACCGCTTTAGTTATAGTGATGGCCTA
TTATGACACCAACTATCACCTGTTGATCCGTTGAGAATCTGTGTCCCCCATGCAACAGATATCAAACAGGAGATTCTATACGAGATCCATTATGCACCAT
CAAGTGGTCATATGGGCCATGAAAAGACATTCATACGAGTGTCAAATGAATTTTGGTGACCACACCTATATCGGTGGGTAGCCAGTTATACTCGATCATG
CGAAGAGTGTCAGTGCGTAAAGCCTGTACCTTCTAGTAGTGAGCCAATGAAGCCACTACCGATATCAACTGATTGTTGGAAGTCGGTCAGTTCGGACTTC
ATGTTTGGTATGCCGCCTGACCATAAAGGCAGGACGATCTCGTCGTCTTTTTTGACATATTGAGCAAGATGATGCATTTAGCACCGTGTAGCACCAAGAT
CTCAGGCAAGGAGGCAGATTTCTTGTTCCTGGATCATCGACTACACGGGATGCCTAAGTCCATAGTTTTGGATGGGGATCCACGTTTTACGTCAGATTTT
TGGCGTCACGTGTTTGATCTGCTTGGTAACAAGCTCCACATGTCTACCACCGATCATACCCAAACCGATGGCCAGACCGAAAGGACCAATCGTGTTGTGG
CGAATGTATTGCGCACAATCGCAACTCCCAAGACAAGGAGCAAACATTTGCCATTCGTGGAGTTTGTCATTGACAACAGTGCTCATGCCAGTATAGGTGA
AACGCCGTTTTATATGAACGGACTGAGCCACCCTCGGACTCCAGTCTCGTTTGTGCGCAGGCCAAGTCTTAATGGGGGAG