Description :
From Genome Similarity Track
Location :
Scaffold_25:179535- 185562
Transcript NameFunction/comments
Physo_133290putative polyprotein
Physo_133291reverse transcriptase

Sequence
6027 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCGATGGAGCAGTTCG
CTCACTTGCCCCCGAACCAGCAGGATGCGCTTAAAAGGCTTATGTCCTTGCTGGACCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCCCCGACACGGT
GAACGCGCGTCTCGAGGCATTTTCAAGCTACGAGAATGCTCTGCTAGAGCACCTCCAGCAGAGGATGGCGACGGCCGCGGCGCCCCAAGCGCCCGCTTTG
TCATCCGACGCGGGGACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGATCTTCGAAGGCAAGGAGGGTGAAAGTGATGCTTTGTACCCGTGAGGTTGAG
ATGGCTATGAGTTCAGCTCTACTCCGGACGGAGTCGCAGCGCGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGTGAGAGAGTGGGCACTAACGTCCG
GGACGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCCCCACCTAACGAGGCGTATCGCGTGCGCTCGCG
CTTTCTGGCCACCAGGCAGAGCAAGAAGGAGGTGGTGGACTATGTCCAAGAGTTGAGAACTCTCATTGCTGGCATGTCTGCGGAACCAATGCCGAAAGCA
GTCACCGTTACGGTGTTCATGGAGGGCCTTCGCACTGGCGTTGCCAGGACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGGCTGTGAGCGTCG
CATTGAATGCGGAACACAACTTTAAGTCGTCAAGACTTGGGTGGAATGCGTCTTACGCTAGCGCGCCGAGTGGTCCGGAACCCATGGACCTCAGTTATGC
TGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGTATCCGCAGATGCTTCATCTGTCGTGACACCCGTCACCTTCGTGCTGGGTGTCCG
CTGCGTCATCAGCGCCAGGCTTCGTCAAGCCGCTCTTCGAGTTCGAGCCAGGGCTCTGGTTTGTCTCAGGGAAACGAGAAGTCCCAGTAGGCGCGGGGCG
GCCAACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGACCCGAAGAGAGCCGTACTCTCTAACACGGAACGTGTA
TGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGTGTGAAGGGCTTCACCAAGCCATGGACGATTTTGATCGATTCGGGAGCGTCGGGTAACTACGCCCGGC
GTTCTACGATGGACGGAAGTCAGCTTTATTCTGAGGCGCTGGTAGCCTAGCGCGGGAGTGACATCGTCACTGTTAGTCTCGCGACGGGCACTCGTGTCAC
GGTGCCTAAGGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGTCTTAGAACTCGATTCGAGATATGATCTCATC
CTTGGTATGGCGTGGCTGGAACGCCATGAGCCTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCCCTGGCGAGCATTGGCGAGTC
ATGAACCCACCTCTGCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCGGATCAAGGATGTGGAGCGGCACTAAT
TCCGCTGAGCGGGCGTGCGTCTGAGGGCGACGCCCTGCTGTGTGCCGATGAAGGCGCGGTCGACAGGAAGTCGAGTGAAGATGGGCGTTGCCCGGATCAA
GGATGTGGAGCGGCACTAATTCCGCTGAGCGGGCGTGCGTCTGAGGGCGACGCCCTGCTGTGTGCCGATGAAGGCGCGGTCGACAGGAAGTCGAGTGAAG
ATGGGCGTTGCCCGGATCAAGGATGTGGAGCGGCACTAATTCCGCTGAGCGGGCGTGCGTCTGAGGGCGACGCCCTGCTGCGTGCTAGCCACAGCGCGGT
CGGCACGATGCCGAAGAACAAGGGGCTTTGCCCGGATGAAGGTCGTGGAGTGGCACATAATCCACTGAGTGGAGGCTGCGGATCGTGCAGCTCTTCGCTG
AGTGTCGGTAAAGACACTGGGGCTCCCCTGGAGCTGAACGAGGTGGTGACACCTGGCGTCAAGACGCACGCGAAATCACGGGGCTCTTCAGGGCGGACGG
TGTCCATAAAGAGGAGGCAGCACCGCAAAGCACTGGCTGCGAGACGCAAGGCGTCTGAGATCTCACGAGTCGAGAAGGGCGTGTCGAGCGATGAGGCTCC
ACGCGAGAGCGAGCAGCTCTATACACTCGTGAATGGAGAGACGGGCGACGTCGACGGAGGTATCAACCTCGACGACTTGCCCTCCCTGTCTGCTCTCCTG
GAGCTGGACGAGATGTCCTTGGCCGAGTTCGGCGAAGCCTTGAAGGCTGGAGACTTGGCTGAGGTAGTGGTCATACGACCCGAAGAAGAGTTGAACTCGT
CCTCGCTTCTGGATGAAGCTGTCCTGGAAGACACCAAGACGGCGCTGAATGCGCGGAGCGGATCGGCGATCCTGAAGGACCCGTCGGATCCCTTGCATCA
AGTGGTAAATGATTACCAGGACGTGGATTCGAAGGAGCCGCCCTCGGGGCTACCTCCGGATCGAGGTGTTCGACACGAAATCGATCTCGTTCCGGGAACG
AAGTACTGCGTGACGAGGCTGTGGCCCTTGCCGAAGGAGCCGTGTGACGTCATTGACGCGTTCTTCCGTGCGAAGCACGAGGCGGGCATGGTGCGTGAGA
GTAAGTCTCCACACTCTACGCCGACATTCTGTGTCAGAAAGCCGAATGGCAAGTGGCGTATCGTGCATGCTTTCAACAAGCTGACTGCCGCTACCATTCC
GGCGCAGACGCCGATTCCTCGGAAGGATGTTCTTCAGAACAACATGACAGGATGTACGATGTACAGTGCGCTCGACTTGGTCGATGGATATTACCAATTG
CTCATGAGGACGAGCGACATTCCTGTCACTGCGGTGAGTACTCCGAGCGGCATGCTCTGGGAGTGGTTGGTGATACCCCAAGGGCTTTCGAACGCGCCAG
CGACGTTTATTCGTCTTGTGACGCAGCTCTTCAGGCCCCATCGGGCGTACGCGCAAACGTACTTCGATAACATCTTTGTCCACAGTCGTGCGGAGCACGA
AAAGACTGATATGGAGAACCATGTGGAGCACCTGCGTGCTGTGCTCGAATGCATGCGTCAATACAAGTTGTACGCCAACATTGACAAATGCATCTTCGGA
GCGGAAGACATCCTTTTCTTAGGGTGCTTCATCGGGAAGCGTGGCCTGAGGGCCGACCCGGTCAAGGTCAAGGCCATTGTTGACTGGCCGGTTCCCAAGA
ACCAGAAGGATCTTCGCAAGTGGCTTGGCTTGGCCAATTACTTGCACAAGTACAGCGATAACTACGCTGAGATGGCTCGGCCACTCTCCAACCTCCTAAA
GAAGGATGCGGAGTGGTGTTGAAACACCGAGCATCAAGATGCGTTCGCGGTCATTAAGGACAGTCTCCTTCATGCGCCTATTCTGGCTCTGCCAGACCAC
GCTCGTCCGTTTAGTGTCGTCTGTGACGCCTCGAACTTTGCCATCGGCTGTGCACTGCTGCAAGCAGACGCCGAGGGACGCGAGCGCGTGGTGGCGTTCG
AATTTCGCCAGCAGAAGGCTGCGGAGAAGAACTATCCTGTCCATGACAAAGAGCTACTTGCGATGAAGTATGCGCTCGTCAAGTTCAGGGTGCACCTGTT
GGGCTCTCAGCCGTTCGTGATTTACACGGATCATGCATCGTTACGCACTGCGACTCAGTCGCCTCACCTCTCGCAAAGGATGGCCCATTGGCTGTCCTTC
TTCGCGGAGTACAACTTCGAGGTGAAGTACAAGCCTGGCAGGCAGAATGTCCTTGCGGACGCGCTGTCGCGCAGGCCGGATTATGAGCTGGCTCATGTAA
CGACCGTGACTTCGTCATTTTTTCGGATTTGATCCGAACGGCTTATGCCAAGGACGACACCTGTGTCGCATTGCTGAAGGCTCTGGGGAGCTAGGAGTTT
CAAGACTCGGACATAGAATTGTCAGCGCGGCTGCGCGCGCGGCTACACCGCTATTCCCTCGATGGTGGCCTGTTGTTCTACAACACTGACCCCGAGGATA
CGCCCCGCGTGGTCATCCCTCATGATGAGGATCTGAAGTATCGCATCCTCTATGAGGCACACGACACGTCGCTGGCAGGCCATCTTGGCCGTGAGAAGAC
CTACAGCTCGGTGAGCACCCACTACTGGTGGCCGAAGATGTACAAGTGGACGAGCACTTATGTGCGCACGTGCGAGACGTGTCAGCGCGTGAAGTCGTCA
CCTCATACTGCAGCGCCGTTGGCGAGCTTGCCTGTCCTTTCGGGCTGTTGACAATCCATGAGTATGGACTTTGTGTTTGGCCTGCCGGCGGACGCGGCGG
GCAACACTGGAGTCGTGGTCTTCGTGGACCGACTGAGCAAGATGGCTCACATTGCGGCTGTGCCGGATACCATCGATGGTAAAGGTACAGCAACGCTGTT
CTTGGACCGAGTGTTTCGACAACACGGACTCCCTGAGTCGATTGTCTCGGACCGAGACCCCGCTTCACGGGCAACTTCTGGAGCGCGGTCTTTGCGGTGC
TTGGCACCAAGCTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAGACACAGCACGTGAATCGCGTCGTCGAGGACGTGCTCCGCAGCATTTG
CGCCGAGACGCCGAAGCGCTGGAGCGCCATGCTGCCACTCGTTGAGTTTGCGTTGAACAACGCCGTGCACGCCTCGACAGGCTACACGCTGTTCTACGTG
AACAGCTTATCTCATCCCCGCGTCTCGCTGACGCCGCCACGTGGTGGCCTCGGGCTTGGTGGGGGAGGAGAAGCCGATTTAGCTGATCGGTTAGCCGATG
TCAGCCCGACTACTGTTCGTAAACAGGTTGACGCTTTCTTGTCGACGCGTCCGAGTGTCTTACGACATGTGCGTGACGCAATGGCTGAGAGCCAAGACAA
GCAAAAGGAACATGCAGATGCCAGGGGCAGAGGCAATGTTGCAAGTTATGAGGTCGGGGACCTGGTGCTGCTTAATGTAAGAACCTACCTACACATGCAG
TGTCTGCCGTCTTCAAGACGAAGTTGCGCCCGCGCTTCATCGGACCTTTCAAGGTTGTGGCCAAGAAGGGCCTTGCGTACACACTCAATCTTCCGAAGAA
GATGCGGACGCACCCCGTCTTCTACGTGGGCTTGCTCAAGCCGTACCAAAACCCGATGCAGGTGCAGATGGAGGCACCGAGGGTGACGAGGTCACAGGCG
CGGAGGTCGCGGTCGTCGAGGACGCAGTCGCAGGCGTCGAGGACGCGACCATCCACGCAGGCACCGCAGGCACAGGCGGAAGAATCGGCGCCGGAGGTGC
CGCGGGCACAGCGAGAGCCGCAGGCGCAGGAGGCGCGGCAGTCGGAGCCTGCATGCGGGCCAGGAGGTGGAGCTGACCCAGAAGCACAGCCTGCTGACGC
TGTAGCTCCCCGAGCTCCCGGCCACGTTGCTCATCGCGATCGCGATAGTATCGCACCTAGTCCTCCAGGGCCCCAAGGCGGTCCCAGACCGCTCGAGGCA
CCTCGATCCATCGCGTCCGCTCGGCGAGCTCGTCGAGTTCGGTGGCAGTCCGGCCCAGACGCGCATCAACGTCATGGATATGATAGAAGGCGACCCGCCT
GCTGCCACACCTCCAAGAGCTCACTTTGAGTCGCAAAGGGCCCCACAGCGGCCTCCACCGGCCCTGCTCGATGAGCATGGGAATCTACATTACCATGTGG
TGCGCCTCCTGGCGAAGCGGCGGTGCCAGGGTCAAAACCAGCATCTGGTGAAATGGCGAGGGTACCCTCACTCCGAGAACTCATGGGAGTTTGAGGTGCC
CCTCCGCCAAGACTGCCCAGACGTCGT