Description :
From Genome Similarity Track
Location :
Scaffold_21:179484- 180927
Transcript NameFunction/comments
Physo_132488hypothetical protein

Sequence
1443 bases(100 bases per row)
CAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCACCCGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCG
AGCCTGGCTTTTATGGCCCCGAGGGCTCTCCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTA
CTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCGATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCGC
GCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATACGCCAGTTG
CTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTG
ATTGGTCGATAAGATCGAATCTAAGTGGGGAAGGATGTAACGGGATTACATGGAATAGTGACCCTGTCACTATTCCGGGATAGCTACATCGGTCACTCCC
CTGGGTGGCCTCAGAGACAACAGATACATTTTGTATGACACAAACTATAGGAAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACA
TTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTC
TGTTAAGAAGTGCTGTGTGCCCCGTCACAGACAGTGTGTATTCCACACACAGTAGTGGGCAATTCTTGATTCTATTTTAAGTAGTTGACTTAGAAAAATC
TGACTTAAGCTCAGCTATATTTCCGTCCCAGCATTTCCATCGCCAAGCAGCCGCCGCGCGCCGCACGACACGCTGCAGGCGTTTAAACTGTGCGGGCAAT
ATTTAACCAAGTCCAGTGGTTGCGGTCACTGGGGAGTCGACGACGTGCAACGCCTTTCGCCCGCCTCTAAATTGACAAAATCACGTAATTTTTCTTGGGA
AATGACTGAATCTGTTTGAAATCCATTTTAATACCAAATCGGTATATTTTGTAACTGAATTGGTATGCGTTATTTTTAATTATTAAGGTGCGAACTACTA
CAGCCACGGACGTCCTAGCTTCCTGTAGGCTCCCCCAAACAAGTGCCAAAACATTCCCTGACGAGGTTACTGTACCCGTGGTATGAGCGCGAACTATTTC
TCGTGCTTATCTAGTGCAATACAACCATCAATACAACGTGGCATGCTGCCACCAAATTGCAGCACTGTCGGGCGGAGGAAGGCTGGACACAGATATAAGA
AGTTTGCTCGGGTTCTCAACGATCTAGGTGCTTAAGGATGTAG