Description :
From Genome Similarity Track
Location :
Scaffold_740:17936- 19040
Sequence
1104 bases(100 bases per row)
TAGCACTAATAGAACTACTATTTCGGAGACGCTTCAACCCATTGAAAATCTTCGAAGGTCGCACGCACGGGGGGGTCTGCTGCCTTCCCGCCTTCTCTCC
CTCGCTCATTCCCTCATTTCTCGCGCCAGAGTCACAACCAGTGAAGTGTGCGAAGATTGATTGTTCCTGGGAAGACGTACCGGAGACGTCTCCGTGCAGT
GTTTGCAGGGTCCGGTACATCACCtgtgcagcaacgagctgtGCACTAACTCAAACCTCTCGAAAAGGTGACACTGCAGTATGTTTCCAACTCTACTTCC
TTCGCGCTAATACTGATAAGACAACGTGCAAGTTTTGCAGTCGTAAATGCGTCAACAAGTACTTCGATTGTGACAGTGATTCGGAGCAGCTCACGCCAAG
CAGCATGTCGGGCATATCGATCTCGAGCTAGGCCTCGGTGATCAATCTCGCACAAGgggaggagctggaagacaAGCAACAAACTACAGACTGTATTCCG
GACGATATCACTCACGCCCCTCCTAAGAACTCGAGAGACTTTATTGGGAATTGATACATAAACTCGATAAAGTAGTTCCCTACAAAGGCAAGCGGTTCAC
TCACATTTGCGTGCTGTGCTTGAAGACcaagacgtcgaaggagTCGCTCTGCCACGCAACCAATGCCAAGACACAGTTGATTTTAGCCCACAAAGATCAC
GAAGAGGCTGTCAAAGAGAAGCAGCGTCGGCTAGGACGGGCGGGTCGCTACACGGTGGATGTGGTTTCCAAGAAGGACGCGAAACTTCCTGGTCCTAGTG
AACCAAGTGCACTTGAAGATCAGCCTTTCAAACGCCAAAAAAACAGGTGGAAGCTACAAGTCAGCCAAGATCAAATCACGGGGCACATCGCACGCTGGCT
GATTCGTGACGGTGTGTCAGCTCCTTTCTATTAATCTACTAATGTTGGTAAGCTAATCGATCTGGTTGTATACACAGGCTTGCCATATAATATGGTGACG
ACTACGGCATTTCGTGAGATGCTTGTCGGCCTCACTGGGGACCTAAACGCAACCAGGTTTCCTAGAATACTATTGCCATTATATGGCAGGCAATCCACGA
AATA