Description :
From Genome Similarity Track
Location :
contig_5:179348- 182641
Transcript NameFunction/comments
g1525.t1RAW34150.1 hypothetical protein PC110_g9519 [Phytophthora cactorum

Sequence
3293 bases(100 bases per row)
TTCACCAGAGGTAGACGGCGTATTCAATGATGTGGTCGACCAGCGGCGGCGACAGGTATCGCCACCGAACAAGCTGTTCATCTGTAACGAATGAGCCCAT
GAAGGCTGCAAACATCCACCCCAATTGCAGCATCGCCTTCTCCTTCCAGCTAGCAATCGACGACGAGGATGCCAGTCCAGCGCTGCCAGGCGCTTGTCGC
TCTCGTCGCCGCAACGCCAACGTGTTCGCGTACACCACGAGGCGGCACTTTTCGCGCTCTGCCGGTGGGAAGTGCCGATGCAATGCCGGACTCCACACCA
CAGCCCAGTCGGGGGACAGCATCAGCCTCACATCAGCGCGAATCCAAGATGCCATCTCCTGCCAAAGTGCGTTCGCTGCCATCACCAGTTCAAAAGAAAA
ACTCAGCACCTCATCCCAGCGCGCTATTTGCAACAATTGTCCTTACGTAGCGTTGCGCGTGAAGCCCCGTTACTCAGCAGAAGCGCAACCAACGTGTTGT
TCTTGCGGGCCATCGCAAGCGTCAATGCCGACGACCCCGTCCTAAGCTCACAGATACCACAACACACCATCATATTATTTTCAGTCTCGCGATTGTGATA
GTGTCAGGATGGCTGAGGAATTACGTGGAGGTGGCGTTCAGGTCAATGCTTTCCTCCTGTAGGAGCCGCCGCACGACTCCAATGCGACTGTGCGCCACGG
CGTAGAGCAACGCCGTCCAGCCTTCGCCCATCGTCACGTTAACGTCACCTCTTGCTCCAGTCGAGAGCCACGCGTCGACTACGATGAGATCTCCATCCGT
CGCTGCGTCCAGGAACGCGCGCTGCTTGAGGCGGCAGTCGAGCGCGCCGTCCGCCATTTACACCGCTGTGTCACTAAGCCGAGGTGCCACTAAAATCGCT
AAAAAGAAGTCGGACCAATCACTAAAATCATTAAAATGCCGTCGGACCAACTGTAAATAGATGGCTACAGTTGAGAAGGGCGCTATTCTGTTGCTTTTAC
TAGTGAAGATTGGACCGCGTTCCATGTGTACTACGACCTTGGAAAGCAGATCTCGGCACCTTCCTCTTCTTCGCGGAGCTCATCCCTGTCTCCTTCTTCG
CTCGAGCCGATTGTAAATTTCGGGACGGTCCTTTCCTTGCGGCTCGGGATCGTGGAGAGAGCGGACTTCCTGGTGGAGACGCCGGCGACGGACTGTCGTT
GTCGATAATGTCCACAATTGTCTGCATATGTGCACGCGAGGTTTCTGCCGCGTCAGGGATTCGAGACCAGGCGCGCGTGCGCCACTTCGTCCACACCATG
ACGGCAAGCGCGACGCCCACTAGCGAGATCAGAATGACTTCTGCGACAAAGGCACCAAAAGCGGGGCTTGACCTCTTCGTCGCCACTCCAGTGGTTGAGC
TAGCCGCGACTTCGGGACTGCCTACTGTGTTGGCCAAAGCTGTTGCTGTTGCGTTTGATTCAGCAAACGAATTGTTGCTGGAGCTGGCGGCGGAAGAATT
CACTAAGAGTTGCGGTTCAGTCGTATCTGCGGTGATTGGTGCGGCACTTTCGGATGTTTGCTGTTCAGTATTATCTGATGCGATCGGTGTTGCGCTGCTA
TTGTTACTATAACCTTTTCCTGTGAACCGTCAAAATATCACATGGACTTAGGACTACGTAGTACGTTTCGGCATCGAGCAACAAACCCAGTGACGTACCA
CAATCAGACTCAGCAAAGCCAACACGCTTGTTCTCCGCATCAAAGATCACGTCGAAACCAACCATGGTACTCGCGCCGAGAACTGGTTTGGCGAAAAAAA
TTGTTAGTTTTGTTGCAATTGCACACACAAGAAAAGGAGACATAATCTTACCGCCACCACTGCGTTCCGAAAAGTGAAAATTGCCATAGTACGATCCGTC
GTCGTCGGATGGTGTGAGATACTGTGAGGCTGGAACATCCAGCTGAATGTCATCGGTACCATCCCCCTTCATTCCAGACAGTATAATGGAAATTGTTGGA
AGGGATGCTAACTCATCGGTGGTAAGCTTCATACTTTTCTCGTTGTACGCGCGACCCCCGGCTGCATTTTTGAACGCATTCAGGAAACTGCGCTGTCCTT
TTGCGTCGAAAAAAGTGTCGGTTGTACCGCTGTCCACAATTATGCCTCTGCCTGAATTGATCGTCCCGGCGTCAATACCAAGCGACACTCCATTTAGCCG
GATGTCCTTCACGTGGACGGGATAATACGCTGACTTGTCATCCAGCAGCGGAGTGTAGCCGACATTGCTTGTGTGATGGCTGTAATCCACTCCTCCAAAA
ACAAGTTCGCCACCATCTCCCGCAAAGCACAATGTAAAGAGGTTCTGCGTGATACGTCCAGCGCTCAGCATGTAGGACATGACAGTCGAGCGATGGCGAC
CAAGACCCATGATGCCGTTCTCCTTCTGAGTGATGAAGAGACCAGTCTCTTTAGTCTGGCAGCCCACTGGGAATCGAAACCCGAACGTCTTCAGTACTCC
CTCCACCTCGTCATCTTTTGAGGAGAATCCTCCGACCCACACCAACTCGTCCACCATGACGGCCTGCCACATGCTACCCTCCATATAACTCTGTTCAAAT
GACAAACACAACATAAGAAGCAGTCCAGAAACCAATTCAAGAAGAAGGCGCATCAATACCTGGGAGATATAGCAGCGGTTTTGCTCACACGACCGACAAG
AATCAAAATCATGGCATCCCAGATACTTGGCCGTCGTCGACTTGGACACATCAAAAAGAGGGTCCGTGTGCGTCCCGCAGCCGTCACAAGTGCTGCACGG
CAACGCCGTCAAGTGGCTACCCGTGTCCACAATCACAGACGCTCGTTGCGCTGGAATCCCCAAGTAAATTTCAGCATAGTGAGTACTACAGTGCACAAAA
GCAAAAATCAGTTGAGAAGCCACTACTCTCGCAACCTGTTCGTACTCACCCTAAGCCTACACCCAATGGAGCTTCACTCAGAGCTAATGTCCCCAGTGTA
AAGTCTCCGTCCGCGTTCCCAGTCTCCTCCTGTGCTCGCCTCCGCGCTCGCTCCTGCTGCGTCGCCAATCGATAGGCCAGGTCTGCACTCGGCTGCTGCT
GCTTGTGCAGCTGAATTTTCAGGAAACTCTGTTTGCCGGCGGCAAGAGATGTCATTTGAGTGTACGCTACTGCTGCAAAGACTGCCAGAGACGCTCGCCA
CCGAGCGCCAGCAGCTCCACTTCGAGACGTCATCGTCAATAACCCGAGTGAGGGCTTCGGCAGTTATAGCGGATCTATTTATAGCCAATGAAA