Description :
From Genome Similarity Track
Location :
Scaffold_91:179331- 185743
Transcript NameFunction/comments
Physo_140913reverse transcriptase

Sequence
6412 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAAGGTACACCAATGGCTACATACATTTACGACCGCCACGACGGGTGGTCCATACACATTCAGGATTCCTATTGGCTGAAA
GCAGCATCTTTTAGCCAATGAGCGACATGTATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGAAGTC
AGAAACATAAAACAAAAATAGCAGTTCTCATCTTTTACCAAAACACGCTACTTGGAGTTTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACT
TAACTCAAGTAAAAGAAACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGGCCCACTACACCTGGTAGCACTTT
GTAGTCCGTCCAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCATGAGCGCGGAGGTGCCCATGGAAAGCT
CCACTTCGCCTGCAACTCATGTTGCACGCGCTAACTGCCTCCACCTGTCAGATCCAGAGTGGTAGGCACTCCAACGACTGTCAACAGTCATTGGAGAAGC
GGCTGTAGCTGTAATGCTGCGCACACTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGATTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTATC
ACGGTGGCGTCGGGGACGACACCGCGCGAGCAAACGTTGAAGCTAAACGTGAGCAACTATGTCGGAAGAGACGGCGAGCCTCTCCTCCGTTGGCTTGTTG
AACTCGACACTGCCATCGCGGCTCGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGAAGTTGGGCGTA
TGGACGCCGACTCTCTGATCCTACGTGCTTCAGCACGTATGAGGGTTTCAAGGAAGAACTCAGACAAGCGTTTGATCCCCCGCAAAATGAGTTTCGGTCG
AGGGCAGAGTTCCTCGACCTACAGCAGGGTAAGCATGATGTCCATGCTTACGCGCAGAAAGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATAG
ACGAGGCGACCAAGGTCGTCACGTTCATGAAGGGTCTGAGAGATGGGCCTGTAAAGACCTATCTCTTCCGTGACTACCCAGGTACTCTCGAAGCTGCGAT
TACTCTTGCGATGCAGGAGGAGTTTAGTCTGAGGCAGGCTAAACTACATGCGAATGCGCCGAGGCTGCAACCGCCTCCGGTCGCGATAGCGGGAGGTCCG
GAACCAATGGACCTCTCGTATGCAACGGCTGTTGGTTATCAACAGCAACAAGGAAGTAATGTACGATGCTTCCGTTGCGGAAGGACCGGTCACTATGCCC
GAGAGTGCACGGCACCCGTGCACCGAGATGGTGGTCGACGCGGCGATGCCGGGCATCGTCGTGGATAAACAAAAAACGCTGGAACCCAGTAGGCGCGGGG
CGCCCTACTGGTAATGCAGTTCCGCGTATCGACCTTGGCCACGCGACACTGAGGACGGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAAGCAAGATG
ACAGGCCTGACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACT
GCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGC
ATGGTACGCGTGCGCTTCACGTATGAAGATCAAGCGTTTGTCGAGATCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGCATGCCGT
GGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTAC
GCACGCACCGACAGGTGCGCGCGACTCCCCACTCGAGACAGAGGCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACACGCGCAAGAGCAG
CAAGCGTCGGCGTCGCCGCCGACGGCGAAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTCTCAGCGAATCAGGAAGAGTTTCCGACCCAAG
GGGTACGGATGACGCAGGCGAGTCGCACACCTCAGCCGTGGAGGCTGACGCGATTCTGATTGGATCAGTTTTGGCCAATAATAAGAGCCAAGGTGACGAA
ACGCCGTCGACTCCGGGAGTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGC
GTCGAGGTGAAGATGGCGTGTCGACTCCGGGAGTCGACGCTGCAAGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGC
AGCCGGGTTGCACGACGAAGCGCCGGGCGACCACGCCGGGCTTGAAGCCGCTCGCCCGCGGGATGAGCCCGCCGGCGGTACTAAAGAAGAACACCCGTTC
ACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACAGCGCATGCGAAGATCGCTGCGCAAGTCTCGGCCTGGGG
CCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGGGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTA
CAGGGAGATGACCCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGA
CGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGTGAGG
ACACTCTCAGTGCGAAGACTAAGAAAGAGCGCTTTGAGGAGCAGAGCTGGGACTCGCTGAGGTCGAGTCCCTTCTACGAGATTCTACGGGAGCACGCGGA
CGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAG
TGGCCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCTCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTC
CGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCG
AAAAGATGTTATCATCGATTCGATGGCCAGGAGCAATATCTACAGTGCTCTTGATCTACGCGATGGGCTCTATCAGATCCTCATGCGTGAGAGCGATATC
CCTCTCACGGCAGTGAGCACGCCGAGCGGCATGCTATGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGA
CGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGGTGAGCGATGTTGAGATGCT
CAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCAAACCTGAAGAAATGCATCTTCGGGGCGAGCGAGATACCCGTGCTC
GGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGT
TCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGTCGAGTGGGTTTG
GACTGCTGAGAGTCAGCAGGCCTTCGATGCAGTCAAGCTGGGTTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCGTTCTACGTTGTG
TGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACCAATCGCGCCAGCTGAAGCCAG
CTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACGGTTCGTGGT
CTACACAGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGG
GTTGAGTATAATCCCGGAAGACTCAACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAGCATC
TTCGTGCTCGTGCACACCGTTACCGGGTGCACGATGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTTGTGCCCAATGACCATGA
CCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCTACTGG
GCCCACCAGTACAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGCAGTCACTAC
CAACTCCACGAGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGTCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCG
CTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACTGCACGTCTGTTCGTCGACATGGTGTTTAAACACCATGGCATG
CCGATCGACATTGTATCGGATTGAGACCCGCGCTTCACTGCGCACCTTTGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGG
ACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCT
GCCGATGGCGGAGTTCGCCATCATCAACTCGGTGCATGCCTCGACCGGGCTTACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCCGAGTCTA
CTCGGGATGGTGACTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGCCGCAACGA
CACGAAGTAAAGCCAAGAACCGCGCGTCTGTACAGGGCACAGACACCGACAAGCGCACGAAGAACGTGTCTGTGCGGGGCACAGACACCACGAAGACGAA
CGCAGAGGCCGGGCCTACTGCTGGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAA
GACGCTATTGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGCAGGGGCAACACTAATGAATTCGAGAAGGGTTCATTAGTCTTGTTAG
CTAGTCAAAACCTGCCTAAACATGCCGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGACCGTTCACTGTGCTGGCACGGCACGGCAA
CGCCTACACACTGGACATACCGTCTAGTATGCGCCTCCATCCGACGTTCTACGTTGGACGGCTGAAGCCATACCTGCAGCACGAGCTACCTAGCTCGGCT
GAACCGAAGCAGAAGACTCGGCGGAAGCCATTGTCCTCTCCAGCGCGAAGTCGCGCTGGAGCAGCGGGTCGGGCTAATGGTCCATCTCGGCCAGAACGAT
CGAGGCGGTCTGGGAGGCCGCCGCAACCTGAGAACACTTTAGAGCGCCGAACCCAGCGCTCTGGAACTACTCCACGACCGAGTTCCGGTCGTGGGGAGAC
GCGAGATCAGGGTCAACACCAAGTTGACCACACACGGGGCGTGTTTCCGCCACCACCGCCGCCGATTCGTGATGCACACGGCTCAACTCGATGGATTGTT
GAGCGGATTGTTGATCACAGTATCCCGAGAACGAACAGGCAACCAGTTCGTTTTCGTATTCGTTGGAGAGGATTTCCTCCGAACCAAGATACATGGGAGC
CACGGAACGTCTTGCTCCAAGACGTTCCAGACTTGGTGAGGTCATACGAAGCCCACCATGCGCTGCATACTGGAACGTAATGCGAGCGCTGCTGTTAACA
GCAGCGCCCGAA