Description :
From Genome Similarity Track
Location :
scaffold_267:17933- 24664
Transcript NameFunction/comments
g6530.t1 glycosyltransferase

Sequence
6731 bases(100 bases per row)
CGGCGGCAAGATGGATCGGCGCCGCGCCGGCTCCAACTACTTTCAGCTGGACGCGGACCGCAAGCGCAACACGTCCAACAACCGCAGCAACTACGGGGAT
GGCCGCGGCACCTTCGGCGATCGGCTCAGCATGATGGACGTGCTGCCTCCCAACACGCAGGGAGGCAACCAGATGCGCGGCGGAGGCCTCCAGGGCGACT
TTGCGGACGAAGTATCGATCGATTTCTGCTGTGAAGTGCTCTACAACAAGTTCGGCTTCCAGTCCGGCAGTGTGGACAACCAGAGAGAGCACGTGCTGCT
GCTGTTGGCCAATTCCAAGGCTCGAGCCAAGCCCCAGGACCCGCCAGGACACCACGTCGTTACGTTGCACAAAAAGCTCATGAGCAACTACACCGATTGG
TGCCAGTTCATTGGCGTGCCGAGCGTCACGTACTCTGGACAACCGCAGGGAGACCTCAAGAACCCGTTGCACATGGATATCATGCTGTTTTTCTTGCTTT
GGGGAGAAGCTGGTAACTTGAGGCACATGCCCGAGTGCCTGTGCTACCTTTATCACCAGTCGGTGAATATGCTCAACCAGGACTTCCTCGGACAGCAGAA
GGTGCCAGAAGGATGGTACTTGCGGCAGGTGGTTCGCCCGATCTGGAAGGAAGCCTCGAACATGCAGAGGAAGAACAGTCTCGGCAAAAACTTGGAGCAC
ACGCAAGTGCGCAACTACGATGACATTAACGAGTACTTCTGGAAGAAGTATTGTCTTAATATCGACATCACGCACATTGGAGAGGAGCTGACCAAGAAAC
ATACGAAGACCTACTACGAACACCGTAGTATCTTCACACTCGTGCTGAACTACTACCGCATTTTCCAGTTCAACATGATGTTTATGATGGTGCTCATGGC
CATCGCATTCATCTCCGCCATCTCGCCTAGTGGCGGACAGCAGTGGTTCGCTCAGTTTGGTTCAATGGGAGATGTCGTAGAGCCCTATCAGCAGCAAGAC
GTCAAGCTCACTTACGTGGGTATTGTGTTCGCCCTTTCGTCGATGGGATTCTGTAAGACTGTGCTGGAAGCCTGCCACGGCTGGCACTTACTCACCGCTA
GTGAGTCGTCCGAGACGTCCTCACGTTCGTTCAACTACGGTGGTGCTCTTGTGCTTCGTATGCTCTGGAATGGTGCATTTGCCGGAATCTTTGGTTTGAT
GATCTACACGCCGCTGATTACGAGTAAGAACACTGAGCTGCTCGACAAGGCTGCCCCGGCCTCTGTTGCCTATATTCTGCCAGGTGCACTGATCATCATC
GTGCAGGCGTTTTCCCCGACGATGATTACAAAAACATTTGCCGCCAAGTTTATCCGTGAGGGTGAGACGTGTTACGTGGGCCGCAACATGGCTCCTCCGT
TGAGCTACCAGATGAAGTACATCACCTATTGGGTGATTCTGTGGTCCCTGAAGGCATTCATCTCCTACTTCATTTTGGTGCGTCCATTGGTTCTCCCGTC
GCTTGCCATCTACGAAATGGAGCTGGAGTACGGAAGCAACGTCGTGTCGTTCCACAACTTCGGTGTGATCGCGGCGCTGTGGCTGCCCGTGATTTTTATC
TTCAACTACGACACCCAGATTTACTTTACCGTGTTCCAAGCTACGCTTGGTGGTATTCAGGGTCTCATCATGAAGACCGGTGAAATCCATGGCATTAAGG
AGATTACCAAGGCCTTCCGTGTAGCGCCCCAGCTGTTCGACCAGAAGGTGGTAACCAATCTAGCTCGCTCGAACGATGCTGCCGCTGATGGCTCCGCTGC
AGCATATCAGTCTCAAATGATGCTGCGTTTCGTGGTCGTCTGGAATGAGATCGTAAACTCGTTCCGCGAGGGTGATCTGGTAGACGACAAGGAAGCTGCT
ATCTTGCAATACGACATTCAGAGCTCGGGCGACGTTTTCGAGCCCGTGTTCCTGTCTGCTGGTAAGTTGGTGGAAGCTCTCGAGTACACGGTAAAGCTGG
CCAAGGAAGGAAAAGGCGATTCGCAGCTTCAGGTGTACATGGTGCAGAAGGATTGTTTGTCGGCTGTCCGCAGCTTTTTCACTGCAAGCATGTATGTGAT
GGAAGCTCTGCTCGGAAGTGATGACGCCGACATTCTCGACGCGCTTCGTCAAATGGAGACGATTGCTGCAAACGGTAGCTTCATGAGCACTTTCGATGCA
AAGAGCCTAGTGCAATTGCGTACTGTATCGATGGAGTTCTTGGAGGCTGTGATGGACTTGCCTGATCCGGATGCTCAGTCGTCACACCTAACGACGTCAC
GCGTGCACACCATGGGTGTTGTGCGTAACTTCGTGACTAAGATGGAGAACCTGCTTAACGCCGTTCGCATTTTCGCGAACCGCCCTGAACTTGCTGCCAA
GTTCAGCAACTCCAAGTTTTGCTCTAGTGCAAACGGCTACGTCTTTGCCGCTCGTGGTTTGGTAAACCTGTTTCACAACGACACGGCTATGGGTGCCGCT
ACGCGCGCGTACTTGCTGATGTCTCTTGAAAAGGCTGATGCTATGCCCCGCGTGCCTGAGGCTCAGCGACGTCTTGGTTTCTTTATGAAGTCACTTGTGA
TGGACATTCCGCAGCTGACGTCGGTCAAGGAAATGCACTCGTTCTCCGTTGTGACGCCGTTCTACAGTGAAAGTGTCCTGATCTCTCTGGCGGAGCTGAA
CGACCCACTGGTGAACCACCCTGTCTTCCAGAAGGTGGAGGAGAAGGGCAAGAATATTACCATTCTGAAGTACCTGATCACGATCCACCCTGAGGAGTGG
GAGAACTTCTTGGAGCGTATTGATGTGAGCACTGCCGAAGAAGCCCAGGCAAACTACCCGCTGGAAATTCGTCTGTGGGCTTCGTACCGTGGTCAGACGT
TGGCTCGTACAGTTCAGGGTATGATGCTCTATGAGGATGCTATCAAGATTCTACACTGGTTGGAAATTGGTTCGAGTCCCGGCAAGACTGCCGAGCAAAA
GCAGGCCCAGCTTGAGGACATGGTGCGTCTGAAATTCTCGTACATTTGTGCTTGTCAGGTGTACGGAAAGCATCGTGCAGAAAACAAACCCCAAGCCGAT
GATATCGACTACCTGCTGAAGACGTATCCGAATTTGCGTGTTGCCTACGTCGATACCATCGCGAGTGACGGTGGCAAGCAGTTTGATACTGTGCTTATCA
AGAGTGAAGGCAACGAGATTGCCGAAGTGTATCGTTATGAACTGCCTGGTGACCCGATTCTTGGTGAAGGTAAACCGGAGAACCAAAACAATGCGCTTCC
GTTTACGCGTGGTGAATACCTGCAGACAATTGATATGAACCAGCAGCACTACTTCGAGGAGTGTCTGAAGATGCCGCAGCTTCTCGTGACCGCAGACTTG
CACCCTTCAAAGAAACCTGTCTCGATTATTGGTATGCGTGAGCATATTTTCACGGGTAACGCTTCGTCTCTGTCGAAGTTTAAATCGTGGCAGGAGCTTG
TGTTCGTGACGCTGTCTCAACGTGTCCTGGCCGATCCACTGTACGTGCGTATGCACTACGGTCACCCTGATATTTTCGACAAGATCATTGCGATTCCTCG
TGGTGGTGTGTCTAAGGCTTCTAAGGGCATTAACTTGTCTGAGGATGTGTTCGCTGGTTTCAACTCTACCCTTCGTGGCGGTGTGGTGACGCACGTTGAG
TTCATGCAGTGTGGTAAGGGTCGTGATGTGGCTCTTTCACAGATTTCTATGTTCGAGGGTAAGCTGGCAAATGGTGCCGGTGAAACTTCCCTGGCACGTG
AGGCTCACCGCATGGGTCAGTTCATGGACTTCTTCCGTTTGAACTCGATGTACTACTCGCACACGGGGTTCTATTTCGCTACCTGGATGACTATTGTGAC
AACTTTCGTGTACATGTACTGCAAGGTGTACCTCGCCCTGGCTGGTGTTCAGCAGCAAATTGTGTACGACATGAACTCGACTGCTGTCATTACTGACAAT
ATTGCCAACAACTTCGACGAGCGTGTATTCACGGATTTGAAAGCTGTGCTGAACACACAGTTCTACATTCAAGCCGGTACCTTTTTGATGCTTCCGCTGA
TGTGTGTGTACTTCGGTGAAGGTGGTTTTGTGCGCGGTATGACGCGTTTCATCGATATGATTATCACGCTTGGTCCTGCCTTCTTCGTGTTCCAGGTCGG
TACGACGATGCACTACTTCGATAACAATATTGTGCACGGTGGTGCCAAGTACCAAGCCACGGGTCGTGGTTTCAAGATTTCTCGTGAAACGCTGGTGCTG
CTGTACAAGGCTTACGCAAGTTCACACTATCGAAAGGCTTGGGAGCTGATCGGTTTGTGTCTGGTGTACCTGGTGTTTGGTAACTTCTACATTTGTCAGA
CCGATGCCTCCGCCAACGACAACACCTTTGCGTCCGACTACTGTGACACTTCTCAGGCTTACGGTGTGCAGACGTTCTCTGTGTGGTTCATTTCGATTCT
GTGGGTGGTTGGTCCGTTCATGTTCAACAGTGACGGTCTTGATCTCAGAAAAACGAAGGTGGATATCCAGCAATGGTGCATGTGGATGTTTGCCCCGGAA
GATTACAAGGATGACGATCCGGCCAACAAGGGTGGCTGGGTTGGCTGGTGGAAGGGAGATCTCGAACAGCTCCACGGCTCGAACATGATTTCGCGTGTGA
CGGTTATCCTTCGCGAGTGTCGCCATTTCCTGCTTATGTTTTACGTGGCTACTCTGGAAACGTCTGATGTCATGTATGTTGCGTACTCGTTCGGCGCTGC
TGTTGCGACGATTATCCTCCTCGGATTTTTCCACGGCATTGGCATGGGCATGCGCTCCATGAGCCCCGTGTCACGCGCTGTGATCTACTTGGGCACTATT
GCTATCTCGGTGACGGCATATTTCCTCGCTACATGGATCGTGCTGGACTGGACTTTTAAGTACTCGATGTCTCTGTTCTTCGCTTACGTAGCTGCTCTGT
ATGGCATTAACGAGTGTTTCCGCATGTGGAGCTTCCCGCACTCTTCGATCGCTGGTATCGCAGTGTTCCAGCAACTGCAGTTCCTGTTCGACTTCATCTT
CTGCACGGGTATGATTATCCCGCTGATAATTTTGTCGTGCATTCCTTTCTTGAACGTTATCCAGACGCGTATGATGTACAACGAAGGTTTCTCGAAGGTC
ATGTCCGCTTCGTCGCAGTACGCGTTCTCGCTTGCTGCTTTCATGGGTGTTCTCGGCGGTGTTGGTGTTGGTTGGCTGTTTAACCTGCTGTCGACACTGG
AGCAGTCTGCAAGTTTTGCGAGTTATGTCGTGACGTACGATGGCGTTCTGAGTGGAAATGTCGGCGACGGTACTACAACATATATGCTTTATGGTGCCTG
TGTTGTGGGCACGATCATCGCTGGTTTCTTGAACTACTTCGTGGGCCGTCGTCTTTCTATCGTGGCTGGTGGTCTCTTTAGCACTCTCGGTATGGTGGCT
GTCAGCGCCAACGATGACCTCCGTTCGACTCTTCTGATGCCTGGCATCGGCCTTCTTGGTGCGTCCTGTGGTATCTTGCTTCCGTCGCTGGCGATTTATA
TCTTCGAAATTTCCACCAAGGAAATGCGTGGTAAGGCTATTCTGCTTCTGGGCATGGGCTTCATCGCAGGTAGCTTGCTGGGTGGTATTTTCGCGACGGT
GAACCAGTTGGGATGGATCTGGCAGACATTTGCTGCTTGCATCGTCATCGCTTTGGTAACTCCAGTGGTCAACGTGTTCCCCGAGAGCCCCTACTGGGTT
CTGGAGCGCAAGGGTTGGGATGCGTGCGAGGCCTGCTTGGTCATTCTGCGTCGTAAGCCAGATGTCCACGAAGAGCTCAAGATTATGCGTGAAGAGGAAA
CTGCTGATGAGGGAGGTGCTGGTGCTTTCAAGTTCCTTATCGGCCTGTTCCTGATGCTCGTGACTTCGTTGACGACAGGCTTCTTGAACGCTTTTGTTAG
CTACAAGGGTGCCAGCGAGTACACCGACCAAGATAAGCTGTTCGTGAACGCCATGGCGTTGCAAGTCTCGGGTGCTGTGATTGCCTTTTTCTTTATTGAC
AAGCTGGACCACAAGTCGGTCCTGTTTGGAACTCTAATTCCGATCGCGATTTGCGCTGGTGTGCTGGGCTTCAACGAGACGTCCGATTTCTTGGGTGACT
CTGAGGGTTCTGGCCTGTACGTCAGTCTGGTCGTGATGCTCATGTACTTCTTCATGGGACTTGGTACGAGCTCTGCTCCTTGGTCAGCTTGCGTCGGCAT
GTTCACCACCAGTGGCCGCGCCTCGTCAACTACCGTGCTGTTTGCCATCTTTTACTTGGCAGACTTGGGCTACGTTTACATGCACACACACGACTCAATG
ATGGCGAACGAGTACTTCTACCTGTACGGAATCGCAGGTTTCAGTGTCATCGCACTGGTCCTGTTATTGGGCGCAGGGACCAAGAAGAACGGTGTCATCT
GCACCAAATCGGAAGCCGAGAAGGACCGTGATCGCATTGCTCGCATGCGTGCCGAGCGCGCAAGTCGCAACACAAGGACTCCGGGTACAGCTCGCCAACG
CAACATGAGCCGTGTGCGATCCAAGTCCAATGCAGGCGGCCAACGGGGCAATGCTACTCCTGGCAACTACCAGATGTACGAAACACCCGCCAATGCCGCG
CCGCCGCTCATGCACGCGCGCGCTTAGAGGG