Description :
From Genome Similarity Track
Location :
Scaffold_16:179256- 180916
Sequence
1660 bases(100 bases per row)
CTTCCTCTGACGCAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCGACACCTGAGTCTGTATAGACTGACCGATGGAGCAGTTCG
CTCACTTGCCCCCGAACCAGCAGGATGCGCTTAAAAGGCTTATGTCCTTGCTGGACCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCCCCGACACGGT
GAACGCGCGTCTCGAGGCATTTTCAAGCTACGAGAATGCTCTGCTAGAGCACCTCCAGCAGAGGATGGCGACGGCCGCGGCGCCCCAAGCGCCCGCTTTG
TCATCCGACGCGGGGACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGATCTTCGAAGGCAAGGAGGGTGAAAGTGATGCTTTGTACCCGTGAGGTTGAG
ATGGCTATGAGTTCAGCTCTACTCCGGACGGAGTCGCAGCGCGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGTGAGAGAGTGGGCACTAACGTCCG
GGACGTCGGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGTCCCGAGTGTTTGCCCCACCTAACGAGGCGTATCGCGTGCGCTCGCG
CTTTCTGGCCACCAGGCAGAGCAAGAAGGAGGTGGTGGACTATGTCCAAGAGTTGAGAACTCTCATTGCTGGCATGTCTGCGGAACCAATGCCGAAAGCA
GTCACCGTTACGGTGTTCATGGAGGGCCTTCGCACTGGCGTTGCCAGGACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGGCTGTGAGCGTCG
CATTGAATGCGGAACACAACTTTAAGTCGTCAAGACTTGGGTGGAATGCGTCTTACGCTAGCGCGCCGAGTGGTCCGGAACCCATGGACCTCAGTTATGC
TGAAGACGAAGAAGCCGAGCTTCGTGCTGCTGAGCAGCGTCGCGGTATCCGCAGATGCTTCATCTGTCGTGACACCCGTCACCTTCGTGCTGGGTGTCCG
CTGCGTCATCAGCGCCAGGCTTCGTCAAGCCGCTCTTCGAGTTCGAGCCAGGGCTCTGGTTTGTCTCAGGGAAACGAGAAGTCCCAGTAGGCGCGGGGCG
GCCAACTGGGGAAGAACTAAGTTCTATTGAGCCTCGGCGAGGTGGAGGTCGACAGGACTTAGACCCGAAGAGAGCCGTACTCTCTAACACGGAACGTGTA
TGCAAGCCGGGCTTGCTAGTTGTCCAAGCTTGTGTGAAGGGCTTCACCAAGCCATGGACGATTTTGATCGATTCGGGAGCGTCGGGTAACTACGCCCGGC
GTTCTACGATGGACGGAAGTCAGCTTTATTCTGAGGCGCTGGTAGCCTAGCGCGGGAGTGACATCGTCACTGTTAGTCTCGCGACGGGCACTCGTGTCAC
GGTGCCTAAGGTCCCTGTGGACCTGGGCGTGAAGTTTTTGGATTTTGATAGCGTGGAACGCTGTCTGGTCTTAGAACTCGATTCGAGATATGATCTCATC
CTTGGTATGGCGTGGCTGGAACGCCATGAGCCTTGGATCGATTGGAGGTCGAAGACCCTTGGTGCTACGCACTTCTCTCCTGGCGGAGCATTGGCGAGTC
ATGAACCCACCTCTGCTAGGAAGCAGAAGCGCTTCTGGCGCGAGCACTGGACCGAGTCGG