Description :
From Genome Similarity Track
Location :
Scaffold_376:1792- 4183
Transcript NameFunction/comments
Hyaar_Emoy2813940hypothetical protein

Sequence
2391 bases(100 bases per row)
TGCACCGAGCAGCAAATCGAGCAAGATGCCATGAAGCTGCTGCAAGATCATTTGGACGTGGAGCTAGGCGGTGTTGGAGCGGGCAAGAGCGACGTCGTGG
GGTTCCAATATCTTGTAATAAATACCCCGAACAAATATTAACGGATGATTGTAGCTTCAACTATAACACTGACCCTATCCATTCCCTGCCCTGTAATGTA
GAAACCAGCAGAAGCTCTTTTGGCAGCACAAGCACGTGCTCACGAAAACTTCACTCAGGCAGCAGCTCAAGTCCAGCGCATCCTCACGTACCAGACACCT
GACGGGTTACTGCCGCACTTGGTCTATGGCTCATCTGTGCCGTCCAATTTACGTTGGATACCCAGTAATCGAACCTTCCACCCCGGTCCTGCATTTTGGC
AGCAAACGTCGCTAAAGGAGCACGAGAAGACAGGTTGGACTTCGTCATTCTCCACCTCAACGATTTCTACTCCTCCTGTGGCAGCTGACGTGGCCTGGGA
GATCTTTCGCTTGGCGCCATATGACTCAGCGCTCGGTGTGCGGACGACTGCTGTTCAGTTCCTGTGCGATGTATACGAGCCGCTCAAGAAGCTGCAGAAA
CACTTATTTGCAACGCGCCGTGGTGTCAGTGGTCTGCTGGCTGCTCGCGTACGTTTCGGAATAAAGATGCTTCATACAGCTTCAGGTGTGCCAGCACGTT
TGGATTGATACTGACATCGTTTTTGGGCTGGTAATTGTTGCAGCACCCATGGGAAACGTTTTCATCGCTGTCTCCGCACTGGAAAGGATTCCTTGCCGAG
GTGAAGAAAGCACCGGACTACGAGGCAGTGGTAAAGTGTATCCCGGAGCAAGCCCGGCGACGTTTCGAAGTCGGTGCCAGTACAATATTTTCAGCACAAG
ATGCAGTGGAGAACATCTACGAGCCCATGATATATCTTGCCGCACGAACACATCAGGGAGTACAAGGCAGTGCAATTAATAATCATGGACTAGCTGCGTT
CGATTCTACCACAAACGATCAATTCGCGGTTGAAGACGTGGAGTTCAATTCTCTTATGCTGCGGTCATCTCTGGGGCTTGTAAACATTGGCCGTGTCCTT
GTAAGGCATTCACCCGTGTGCACGGGTTTTTCCTTGACCCAAAAGGAGCTTCTTGTTGAGGTGGAAGAGCTTCGGGAGCTAAGTGAAGGTCTGAAGGTGG
CTCTCGTCGGCAGCGACATAACTCGAGGTTTGTGGAACATATCGACTGACTTTTTCGCTGACTCGAGCCAGGTTGCAATGACTGCAGCTCACTCCTTACG
CGGGTTTCTACCTGGGTATGCTGTGGAGCTAGACGACAACAAGAAGATGCGGTCGATGAAGCATTTTCTTTCCGAGCCCGGTTCGTTTTCTTTCTTTTGC
GCTCGGTTCCCGGCTTCATTCATTTCGTCATTCATTTCGTGTTCGGGGGACGATTGGACCGAAAATGCTGGCTCAAAGAGCCACCGTCCAGCAACTACTA
CGTGGCTTCTCTACAACTACTTTCTACAGCGGGGGTTTGTCAAGGTACGCTTGCATCGTTTGTTATTGTTGTAGTGCACGAGTCAATCACGTCTGCTATT
GAACTATGCAGAACAAGTTTCCAGGACTGGCAGATTATGTCCGCAACAAGACCAGGGATATGGTATGCGAGGCAACTGCGTCGACTCGACCGTCTCTTTT
CTGGTTCCCGCTTTTGTTGGAGGCGGAAGAGCCCGTTCGAACAGCTCTGTCACCAGCTTACAACTCTCACGATGGCAGGCCGGTCGAAGCATTTAACGAC
AATTATTTGGACTCGACCCTAGCTGCTGCTACATTACTAAACGTTCTGCTACCCGCAGGTACGCAACAGGAACGTGTCCTTCGCAGTCTCAGTACTAACT
CAATTTTGTCGCGACAGTGACGCCACCACCGAGTCCAGACACGCCGCCTATTGACCATCATATTCTCTCCGTTATCATGTGTGTTGAGCTGGTCGTAGCT
TTTGGAGTCGCTATGAGCTGTTTTCTGTTTTCAGTTTATTTTGTAGCGAATCGACCGCGACAAGCACATCACTTTCCTGTGTCCACGGCTTGTCGACAAT
CAGCCGCAGAGCATGCAGAAAGGATTTCTCAAGGAAAACCAGATCACAACATCAAGGATGTAAATGATCGCGGTGCTAGCGGATATTCGTGGGTTAACAG
GTACTCGGAATCGTCTTTCAGCGATTGCTCTCCAAGATCCGAGTACGCTCCACAGGAACTAGAGGAATCGTTGCTTGTCGCGGCCAGCGGGCGTTACGGA
TCATTCAATGAGGATGCGAGGCCACAAACTACGTCCAATTTTGTCTGGAAAGCTGGAAAAAAAGTGCTAGCAGCCATCAGCCCCTGGTGAA