Description :
From Genome Similarity Track
Location :
Scaffold_2378:179- 3010
Sequence
2831 bases(100 bases per row)
TGAGGGGATCTGTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTTGCGCTCCTGCGC
GTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAG
GACGTTTGGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAG
CATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTG
GATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGATTGCCCGGATGGGATG
TTGTACGGGCCAGATCCACTTACGCGGAAGGGCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAGATCCA
AAACGGCTGGTGATTTGTGGGGAGATAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAG
TGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAA
TCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTTGTTACGTTGAACCGACTAGAATGAGTGGTGGTAGTGGGGTCCGGGAAAAGGACA
GTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCC
TCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGTATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTATAGCAT
TATCGCTACGGATTACGCGGTGGATCTGAATGATCCTGCTCTTCTATTGCCCCCCCCCCCTACGAAGAGAGTCAACGAGGATCGGGCTGGATTGATGAGA
CTGGTGATGCCGAAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACTAACGGATCC
GGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACAGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGACCCACAATCGAAGG
GGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAGTCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTG
TTGATTTGGGTGGACTTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTCC
GAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCTCGGGGCAGCGACAGCG
AGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTACGTCCAGGATTTGGATCAG
AGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGTGATGAACACCGCCCAAGACAGAATCCGGGGTGATACCCCATTTTACTTGGTACATGGGTGGA
ATCCCCAATTCCCCCTGGAGAGCGACCTTCCCATTTGGGCCACCCCCCAGAAAGAGAAACCGAGATTCCAAGAGCGAGGGGCGATACCACATTTCACAAA
AATACTTCCCCGGCAAGGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCAAGCGGATCGACACAACGAAGACGCCCGTCCACATCA
AATCCAAGTGGGATCGTAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCACAAATTGGCCCATCTATGGCATGGACCGTTCCGGGTGAGC
GAGAAGATTGGAGAACACGCGGTAAGGCTGGAAACGGCAGGTACCGAATATCGCCTGTTTTCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAAGAAT
ATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGGCCCCGTCGACTTCGACGAAGTCCTCCTACCAGAAGATAGTTGGAACGTGGATCTCGA
AGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTAGCGTGGA
TATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGCGAAGCATTACGCTATGATTTCTTGCGGGATCGTACGAATCGGAACAGATTCGGCGTGA
TGCAGTCTCATGAAGAAGAGTAGGAGGGGGATCCATGGATGTAAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGG
AGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGAAAGGAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAATGAATGTTTATGC
ATAAGAGTGACGTTTTACGTGTGAGGAGTCC