Description :
From Genome Similarity Track
Location :
Scaffold_2303:179- 2913
Sequence
2734 bases(100 bases per row)
GATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTG
GCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCA
GATCCGCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTAC
GAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCT
ACATGAAGTGTCAGTTGCCAAGGTCTCTAGTTTGCGCCAAGTGGATGCGTTTTCCAGATCCGAAGTTTCTTCAACCCTGGATCTACACAGAGGAGAGGCA
CGTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCC
GTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGT
AGAGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTACCAA
GTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGG
TGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCAGCCGGAGTGAGGTTGGATCTGGCGGA
TGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACCACC
TGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCG
TAATCCAAGGACCAGGTCGATCACAATATCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGC
GAAGGATGGTATCCCTAGGCGACCTAATATGTGTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAAT
CTCTCGGGGAGGTGGAGCTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATTGGCCTTCATACCAAACTCCGCGAAAGATCCTGCAGAGGGATCGTCGGAC
TGAGGTCCAAGCGACGGAGGTTAGATCCAAGACCGGGGATGATCCCCAGCGTCGGCCCCTAGATAACGCAGGGTCGGTGGATGAAGGATCGCAGAAGGCT
GAAGCCGGACCGCCAGATCCCGGTGACCCCAGAGTGGATCCTAACTTTTCATGGGGCAAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAAC
CAGAACCGTCGGGTTTAAACTCGCTAGAGGATCAACTAGATCCAACTGGTGGCTTCCCCGATACCAGGGTACCTGATCCCACGAAGACAGAGGGACTTAC
AGGTGAAAGAGAGTCGCGGTGCTTGGATCCAATGGCGGATCCGACGAAGACGGAAGATGAACAGGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAG
GATCTCGGAGAAGGCCTGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGACGATGTCCAAGTGGATCCAGAGGCGAACGAACCCG
CGGAAGTGGATCTGTTACGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGA
CATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGGTTAAGGGCCTGCTGCAA
GCCAAGATCATCAGTTTCGCAACGTCCCCGTGGGCATCTCCGGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGG
CTGGTTAACAGCCTGACTCGATTGATGGTATATCCGATGCCTCTAATCAATGAGCTATTGGAAGATTTGGATAAAGTACTCTGGTACTGTTATCTAGATA
TGGCAAGTGGTTTTTGGGTGGTGACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCATTTGGGCTGTTCGAATGGAGCCGGATGCCGTT
TGCATTGAAGAATGCACCCCAGATCTATCAACGCCTGATCGATAATGCCCTCTACGGATTTACCCGAATACCGTAAGCCGAAGGGGATGGATCCGGGGGA
GGTGACGCGGAAGTGGATCCATTCGAAGCAGGAGAGCCAGTTGATCTGGGAACCCCATCCGTGTTAGGGCGCAGATCCTATAGCGACGACATTCAAATCC
CGGCGGAATCGTGGGATCAGCTGTGCGAGAGAGT