Description :
From Genome Similarity Track
Location :
Scaffold_11:178998- 186921
Transcript NameFunction/comments
Phyke_g1521hypothetical protein PHYSODRAFT_508298
Phyke_g1522hypothetical protein PHYSODRAFT_286397
Phyke_g1523hypothetical protein PHYSODRAFT_334052
Phyke_g1524hypothetical protein PHYSODRAFT_546562
Phyke_g1525hypothetical protein
Phyke_g1526hypothetical protein PHYSODRAFT_248120

Sequence
7923 bases(100 bases per row)
TGTCAAGGTGAAGCTGATTGAATCGTGGCGCGACCTAGTGCCATACGACCCTCGTCACGACGATCAGAGTTTCCGTGACGCCAAGCTTCGCGAGCACGCC
AGTGAGAGGCATGCAATGCTTTCTCAGCACCACAAGGTACcgccagcagtagctgcttCCAAGTCACGCGAGTGGACCACTCCGGCATTTATTCGTCTAC
CAGAAGCAGTAGCGACGCGTATCGCTAGTCAAGCTAATACCGAGGAAATGCGTACTCAAAGCGACCGCATGCGTCATGTGGTCGAGTACGAGGTGCTAGC
TGGTGAGGTTCCAACTCCAAGCCCCAAAGAATGGGAACGAGTTAATGAGCCCCATCGTGGACCTGCTTTAGAGGTTCCGCTTTCTGATATGGCTGAGGGC
CAAACTAATAACGTACCCATGCCCGTGGCAGCATCTGCTCCTATGATGGCCCCACAAACGAGCTCCGCGCCACGGAATGGGTACCCTGCTGGAGGCTACA
GTCAAGCTACGTCAGGTTTTGATCAAAGAGTCTACAATGATCGCAGTGAGTACAATGGGCACAGCGAAGCCGATGCTGAGCGCAAATTGCGTGAGGCATT
GGGTCCGCTGCACGAGAACACGGTGGCGTTGCTTCTTGACAATCAAGATGCTGTGCCGCAGGTGCTTGATGAAGTGCAGCGCTACGGTAACCGCATCTCA
GACTCGCGAGTGCACGAAATTGTGGAGCAGCACCGCCGTGCACGCTTCCAGCCGGCTCCTAATGCTGGCTTGCAACAACCGCCCGCATATAGTCCTTACG
GtagtcagcagcagcaatacgGAGACATGGGCCAATACCAGCAgtatcctcctcctcagcagGGAGCAGGAGTTCAGTACATGCCTGGCAAGCGGAAGGC
AGATACCATGGGTCCTCCTCCGCAGAACGGCCAGCAAAAGAAGAGCAGAGCAGGCATGCATTGCAGATTTTTTGCCTCACCCATGGGCTGCAAGCATGGC
ACCAATTGCCGCTATGCACATGTTCAGGCGGGCCCTGCTAACGGCCCCGAGCTTATTTATAACAACAACGGTCCCATGATGGGTGGCCAAGGTGCTGACC
CCGTCAATCGATATGGCCCTGTAGGCATGCACGGAGTTGTTGGCCACCACATGCAGGGTGGACGATGAACGACTGTCAAACAGTGGAAAACTTTCAATAT
CAAATCGTCCAAACGTCATCTGCCTCTCTCAATCCTATTGATGTGGGCAGCAGAAGCCAGCCAAGTGCTTGTTTGTTCCATGACGTCGAGTGACTGACAA
CGGCGAAAGACGTCTATTCACGAGGAACCAAGTAGCAGAGGCAGCATAGCGTGATCTAGCAACATAGTACTAATAACCAACAAAAACTTTTCATGACAGA
ATATTTTACTTCTGACCACACATCTCATGATTAAACGTGAGCACAAAACTAAACGAATTGCGCAGCGAGTAACCAAGAACTAAGCATGAAAGAATGCGAA
CTGTTTGTTTGCCAAATGGAGCATTGTATATTGCCTTTTGTCCTGTTTGGTTATTCGACCCCACACCTATCCAAGAAACTCGGAAGACCTTGCCTCAGGA
AGGCGTTGGGGAACAACACGCGTAATGCAGAGGCGAGATGTCCCAGGACCGCCACCTTTCAAAAGGCAGGACGGGAGCCCAAAACAACTAACCGCAAGCG
TAAAGCAGCTTAAGCCTTGACCGACGAGGCCttgcggctgctgcgacGCTTGGCGATCTCGCTGGCACGAcgctccttctgctccttAACGCGCTGCAGT
GCCATAAGGCGAAAAAGGAGCAGGACAGATCCAGAATTTGCACATATGAATAGTCAGTATCATATCACCGAAAGCCACGTCAACATATAAGCCAAAGAAC
AAGACGAACCTGAGCGTGGAGACGGTTGTACTCGGCGGCATCGCGCTGCACCTTCTCGCGCTGCTGCACCTTCTTGAGGGCAATCTGGCGCTTGTGGTGG
AGCACACGCGGGGTCACAAGACGCTGAATCTTGGGGGCCTTGTCATTCTTCTTGCCCGTCTTGGAGTCGAACTTGCGACGGATCACGTACTTACGCACGT
CATCCTCCTTGGTCAAGTTGAACAGCTTACGGATGTTCGAGGCACGCTTGGGGCCAAGACGACGCGGGATCTGCACGTCCGTGAGGCCGGGGACCTCGGC
GTCACCAGCCTTGACGACCACAAGGTTGAGGACCGAAAGGTCCGGGCCGACGATGCAGCCACGCACCGACTTACGCTTGCGCTCACCCTTGCGACGGGGA
CGGTAGCACGTCTTGCCCTTAGCCAGGAGAAGACGGGCACGGCCGTTCGAGAGCACACCCTGCTTCATGGGGAAACCCTGCTTGTCGTTACCGCCCGACA
CGCGGAAGATGAAGCcgttgaactcgtcgccGAGCACACCGCCCTCAACCTCCTGGGAGATACGCTTGTCGTAGAACGCGCGGAGCTTGTGCTCGTCATC
GATCTCGAGCACCTTCTGGGCGCCAGTCAGGGGGTTGGCAATGTTGAGCTTCATGTTGAAATCTGTAGGTAGCAAAAGTGTCTAGAGTTAGTTCTTTAGT
GACTGAAGAAAAAAGAGTTTGTTCTGCGTGtctgttgttgatggtgtCGATATGGTTGGATAGCTGAGGGTGTTATCTACAAGATGAGTGTGATGGTAGC
TTCCGGTTCGTTCATGCATCAACATCAGACACGCCTACACTAAAATCGCAGTAATTTTGCCGCTTTCGTACCTCACAAGACAATAAGGACAATGGAATTA
GCAGCGCCAAAAGCTCGGgcgaccacgaccaccaacCCTCACAGGCGCTCTTCCAAGCCAACCAAGTCGCCAGCTGCAAAATCCCATTGAAGCTTCGATA
CACTTTGAAGAACACAATATTCCGCATATAAACATTTGTAGCACATACAAATTATGAGAAATACAAATGTGAAGTAGCTTATAGGATAATACCTAGAATT
GCAAGAATTTGAAATTGACCTACGATCTAGGCTTCTAGAATGGCTCATGGCCACAAACGAAAAGCTCGTTCGGTCTTCACCATGGGTAACCAAGTGAGta
ctcctgctgctcctgttgccGCTTCCCAACAAGGAGGTTGCCCTGTGCAGCACGACGCCAAGTCCACATCAACCGAAGGTTACCCTGTGCAGCATGACGT
CAAGAAATCTACCCCCGAGGGCTGTCCAGTGAAGCACGACGCCAAATCTTCAGTAGCGGATACTATGAATGGCGGTTGCCCCGTAGTGACCGAAGGCAAG
GACTCCAACGAGGTCTACAACGTCTACGGCCAGCGCATCGACCCTACCAACATGATGCCGTACAACCCGAACCAAGACCCGAACGCAGAGCAGCGCTACC
CTCTTCCCCAGGAACGAGTGCAGTCCACGATCCCCAAAGGAGGAACCGAAGGCACGTGGCTCTATCCATCGGAGCAAATGTTCTTCAATGCTCTCAAGCG
CAAGGACAAGGGAGAAGACGTGCACGAGGGCGACGTGAAGACCATTGTGTCCAtccacaacaacatgaaTGAGCGTGCGTGGGCTCAGGTGGAACACTAC
GAACAGGTCTGTCATCCGGACCTTACGAGCTCCAAGCTGCTCAAATTCTGCGGTCGACCAGACAAACTCACGCCCATTGCGTGGGTGAAAAAGATGATGG
GATATGGCGAGCCTTTCGACCGTCATGATTGGACGGTGCTCCGTGGAGACAACACACAGGTGCGCTACGTCATCGACTACTACTTCGATGACGACAAGTC
TTCTCAAGATCAAGTGCCGGAACTGCACTCAGCTGATAAGGTCAAGAGTATCTCCATGTATGCGCGTCCTGCAGTGGACTCGGTAGGAACTCTGGTTGAC
CGTATCAAGTTCCCTGTGatgagcttcatcaacgagctGACGGGTCCCGATATCACGTCTCGTTCTGCACTGGTGGAGCGTGCTCAAGAGGAAAAGGACG
CACCGGAGCCTCTGTCTGTGCAAGAGGTTGAAGACACGTTTGCTAAGGTCAAGAATACGTGCAAGAACTGCATGCAGGAGGTCAAGACGTGCAGCAACGA
AGTGCAGTGCTCGCAGGCAGCCATGGCTCTCCAGCTGTGTATGGGTCGCATCATCTGCCCGCCGCAGGCCGCTGCATTTTCCAAAGCACTCGATAATGGC
GACGAGACTGCTGTTGAGGCCGCTTTCGAGGCCATGAACAACGGCTTGGAGCTGTTCCAGGAGCGCAGTGCCAGCGCTATGCAGGAACAGGCAGTGCGCG
AGTCCCTGGCCAAGAAATGAGCGTGGCCTAGAGCTGCGAGATGTGTAGGCAGCTACATGTCACGATCTAGACGATAGTATATAGCCAGTTTTTTTCATAT
TGTTGAGCTGGCTTCGTtagtcatcttcgtctgaGCACACGATCACTTCGCCTTTGCTATTGACGTACTGGTTTCGCAAATGACCAGCACGTAGTTGCTC
CAGTTTGAGGCTTGCAAAGAAATCCTCCGCTACAGCGCAAGATAAGCATGGTCAGTAGTGATAAATCACCAGGTCGAGGGCATTGTCGTTGCTTACACGA
TTGGGACCAAGTGGATGTAAGCGCTCCACGCTTTTGCTTTAGCAAAACAGTAGTATCATGCCGCTCTTTCTCAAGAGCGCGGGTGCGCTCGATCGCATCA
TAATGCAAGAGTAGTCGATGGAGACCTTCATGGCGGTGATCAAGGGCGTATTGCACGGCTGAGTTGCCCTTCCGATCGCGAAGAAAAGGATCGGCGCCAT
TAGCCAGAAGTAGTTTAGCGCAATCTTGTAGTCCATAGCGAGCACAGAACTGCAGTGCTGTTTCTCCAAATGCATTCTATGTAGTCAGGACAAGTGTTTA
GATGATAATCCACGACATAACAAGTGAGCACAAAGTGTTGGTATCGTACCTGGGCATTcacatcagcaccttgcGCAATTAGAGCTACCAGAATATCTTG
AACGCGTTGGGCGGGCACAACCAACGCTGCCATATCTCTTAGATATCCCCTGGACTCCAGCTCCCAATCTCTCCACAGAAAATGGATCGCTGTGTCCCCG
TTTGCAGTTGTCAGCGACACGGCAGCCCCGTACTCAAGCAAACAAAGTACAAGGTCAACACTCAAGCAGCGGCACGCTGCCATTAACGGTGTCAATCCCA
AGCTTCTGTCCTCGTTTACTGCAATGCCTTCTGCGCCCTCTCTTGAAGTGAGGCGGACGGGAATATTCACATCCAGGAACTCGTGAAATGTTAGCCACGC
TATCACTTCGCTTCACAACCAGCATCCAACAATTCAGCACAGGCTGACCTCAAGTTAGTTGTCGCTCATTGGTTTCACAGAATTGCACAGCAAAATCTCA
CCGTTTCGGAGCGGCATGCATTAACCTCCAGAACTGCTCTAATCcgtgtcgatgctgcacttgaGATAGTCGAAGTTGTCTGTCGGCTTCAATCTGTTTA
ACCTGCTCCTGTTCACTGTGCAGTGTCGTCTCAAGTTTGCCCATGTAGTGCTCAAGTTTTGAGCGACTGTGACTCCGTTCTAAACCAAAGCTGAGTACAC
TACATTCCTTTCTCCTGTGCCCATACAAATCGCTGTCTCTCACTGGTACAGCGTTTGTGAGCAAGAGCTTTTTCTTCGCAGCGACGCCCATTTCATGCTC
CTTTTCCAATTTATACTGCGAGCCTGCGATCGGATACGCATCTTTGATATAGCGCGAATGGTACTTCCCGCGCATGTTCATCTGTGCTTGGGTGCCTCCT
GTTTCGTATTGTTTTGCAAGCAACTGCAGTTCCTCTTCCCCAAGATCGTCAAAGCGAGCGTAGATGCTGGATGTCCTTTCCGACATGGacgtcgctcttc
cagcGACCGTCTTGTTGTCTTTTGCTTGTTTCGCTGCACGTACGTCATCCCGACGCGCTCTCATGGCGGCGGCATCCATCTTGAACTCCTCTTCACGCCG
ATCCTATCTCAACGCCACCAGTAGATTAGCGTCCATTGCTATCTCCGAATGACAATATCAACAAACGTCTCACCGCTTCCAAGCGATATCGATGCTGGAT
TTGTTCACGATGATGCCGCAGATATGCAATGCGCCGACGTCCCACCTCTTGCGgatcatcgtcttcatcaaggTCCTCCTTTGGCATCGTTATCGTTTTG
CACCGCGAATTCCCGGTGGGTGGTATATAGTAACGTTAGTCGTAAGGGTCGCTACCGATCTTTTCTGCCACTTCCCGTTTCGACCACCTGGGCAAAGAAC
ATGAGCGTTCCGCAACGCCACAAACGGGACCCCAAACTGCAGGTTTTCTCGAATGCCGACACGCAGGCGCTCCTTCGATGCACCCGGACACTCCTTCCGA
CGGGGGATCGAGGGTGGGAGCGTGTATGGACGCGGTACCGAGCGACCTACGCCAAGGTGAAGCACCAAGCGGTTCGGGACGCCGCGACGCTAAAAACCAA
ATTCGCGGAATTGCTCGACAACAAGATCCCCACAGAAAGCCCCCTGTGCCCACTCAACGTCCGTGAAGCTCGAGAAGTCCAGACCCTGATCGAGACTAAA
GTCTCTCGTCCACCCGGTTCCTACGCTAGCGATGATATGAAGACGCCGCACCAATTGAGCGGCGCTCAGAGTACCGGTAGCAATGAGGACATGAAAGTGC
AGCACAAAGGGGGTGTTGCTCTAGGCAGCAACTCCAGTAAAATCTCTGAAAAGAGACccaagctgcacgagcgCAAGCATTCGGCGACTCAAGTTCAGCC
TCATGGCCATGGCCATGCACACCCAACTCATACACACACACCCACGGTAGCAACTTCAAAGCCATCACCTTCGTCTTCGAAACATCTGAGCACTTCAGTC
GTACGACCGACACACAGCGCTAAAAAGCGCAAGATGGAGCCATTGGCTAAAGACATGGAGGAACAAGCGGAGCGTGTCGTTCTCAGACTGCAACTTGCAT
CTGAGAGCGCGGAACGACAGAGACTGCAACACAAAGTTGACCGCCTGGAAATGAAAATGGATGATCTGCGAGACTCGCACCGGAAGGACGTTGAGAAGCT
CCGAGGCAAGAATATCAAGCTCAAACTCAAGTTGAATCGCGTCCTAGGCGCGGTGTATGTCCTCCGTGCAACGCAACACTCTCCACAGACCGAGACTGAG
TAGTTTGTGGTACTCTACTGCATGCATGACAAGTAGTATCTGATAACAATTGACCCCCGAGTGCATTCGCTACTATATTGTGTTtactgctgcttcacgt
GCTGCCATATTACTGACCAACAATTCATTCGGTCTACGCCTTGAGATACCAAGCAAACGGCTTGTCGGCGACGTAGGTGCAGATCTGCTTGGGTTCGAGG
TAGGCATTCAGGCCGAACGGTCCGAGCTCGCGGCCAAGACCGCTCTTCTTGACACCACCCCACGGCAGCTCGACAAAGCACGGCTGTGAGCAATTGTTCC
AGACAATTCCTGCACGAAGAGCTTTGGTCACACGTTTCAACTGTACATTGTCTGAGGTGAACACAGCAGACGCGAGACCAAATTCCGAGTCGTTGGCGAG
GGCAATGGCCTCCTCTTCGGTTTTGAAGGTCATGACGGACAAGACTGGGCCGAAAATCTCCTCTCTCCACACGCGCATGGTCTTCTTCACGTTGGTGATG
ACCGTGGCCGGCACGAAGTATCCCTTATTATTGGTAGGCAGCACTGCTTGGCCTGCCACGGTCGCGCCTTCATCCTTCGCGGACTTGATGTACCCCAGCA
CCTTCTCTTGCTGAACCTTGGATACCAGCGGACCCATTTGCACTTTGCCATCCAACGGGTCTCCAAGAACAAGCTtctccgtctccttcacAAGCAGCTT
GATAAACTCATCGGCAAAGTCCT