Description :
From Genome Similarity Track
Location :
Scaffold_227:17899- 20027
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_227-fgenesh-gene-0.3TRNA uridine 5-carboxymethylaminomethyl modification enzyme gidA

Sequence
2128 bases(100 bases per row)
TACGATGTGATCGTCGTGGGCGGCGGCCACGCTGGCTGTGAGGCTGCGGCTGCGGCGGCTCGAACTGGTGCGTCACCACTGTATCATAGACATCATCACC
AATGCTCCATTCCAATTCCACTAACTAACTCAATTGGCTGTTGCGTGTGTGTGGTGCAGGCGCGCGGACGGCGCTGGTGACGCAGAAGCTCGCGACCATC
GGCGAAATGTCCTGCAACGTACGTTGGCTGTACTGCTTCATTGTACAGCGGCCTTCCTTGTGTTCCTCCCTATTGACTGACTTGTCTATTGTGTGTCGAG
TGCAGCCGTCGATCGGCGGCGTGGGCAAAGGTACGCTCGTGCGCGAGGTGGACGCGCTGGGCGGCCTCATGGGCCGCGTGGCGGACGCCGCGGGCATCCA
GTTCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGTGCGCGGGCCGCGCGCGCAGATGGACCGCGACC
TGTACCAGCAGAACATGCAGCAGGCGCTGCGGGCCACGGCCAACCTGTCGCTCGAGGAGGACGGCGTGGAGGACCTGCTTTTATCCGCTGACGACCAGCG
GATCGAGGGCGTCAAGACCTCGAGCGGCCGCGTGCTGCGCTGCTCGAACGTGGTCATCACGACCGGCACGTTCCTGCGCGGCGTCGTGTACCAGGGCCGC
GACATTTGCTTCCCCGCGGGCCGCCACCTCCGCGACTCGGCGGGCGTCGAGCCGCCGTCGATCGGGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCGGTTCGAGTTCCCGCTGGGCCGGCTCAAGACGGGCACTCCACCGAGACTCGACGGCCGCACCATCAACCTTGACGGACTCGAGGAGCA
GCCGAGCGACGACCCGCCTCGCCCGTTCTCGTTCCTGCTGGAGGGCGACCGCGTGCCGCTCTTCGATCGCCAGATATCGTGCTTTGCGACGTACACGAAC
GAGGACTCGCACCGGATCGTGCGCGACAACCTGCACATGCTGCCGGAGTACTCGAGCGGCGACGGACAGGGCGTCGGGCCGCGTTACTGTCCGTCAATCG
ACGCCAAGGTCGTGCGGTTCGCCGACAGGAGTCGGCACCAGATCTGGCTCGAGCCCGAGGGTCTCAACACGGACATTGTCTACCCGAACGGCATCAGCAC
GGCGCTGCCTGCCGACCTGCAAGTCGAGCTGCTGCGCACCATCAAGGGACTCGAGAAGGTCGAGCTCGTGCGACCGGGTTACTCGGTCGAGTACGACTAC
GTGGACCCGCGGTCGCTGCACCCGACGCTCGAGACCAAGCAGATCGGCGGCCTGTTCCTCGCCGGTCAGATCAACGGCACGACCGGGTACGAAGAAGCCG
CGGCGCAGGGCATCGTCGCCGGGATGAACGCCGGGCTCACGGCGACCGACCGACCGCCGCTCGTGCTGGACCGCGCCGACGCGTTCATCGGCGTGCTGAT
CGACGACCTCGTGTCTCTCGGCACGAACGAGCCGTACCGCATGTTCACGTCTCGGTCCGAGTACCGCCTGCTGCTACGTCCCGACAACGCCGACCTGCGA
CTGACACGGCGTGCGTTCGAGGCCGGCGCGGGCGTCGCGGACGAGCGGATGGCTCGGCTCGAGCGCAAGGAAGCGGCGATGTCCAAGGCGAGAGAGGCCC
TCGACGGATTCGTGTGTGACCCGCACCAGTGGAACCGGTACGGCGTCAAGGTCGGGCTGGACGGAGTCAAGCGGTCGGCCGCGCAGGTGCTGTCGTTCGC
GGCCGTGACACCGCACGACATGGAGCGGATCTGGCACACGGCCGAGTACGACAAGGCCGACGCGCTGCCGGACGAGATCAAGGAGCTCGCCAAGATCGAG
TGCACGTACGCGGCGCAGCTGCGGCTGCAGCGGCAGGAGATCGACGCGTTCCGCAAGCGGCAGCACGTGCGGATCCCCGCGTGGGTCGACTACGCCGAGC
TGCCCATGATCTCGAACGAGGAGAAGGAGAAGCTGCAGCGCGCGCAGCCGGCGACCATCTACGCGGCGAGCCGCATCTCTGGCGTGCGATCCGCGACGCT
GCTGCTGCTGTACCAGTACGCGACGCGC