Description :
From Genome Similarity Track
Location :
contig_5:178954- 182247
Transcript NameFunction/comments
g1322.t1hypothetical protein

Sequence
3293 bases(100 bases per row)
TTCACCAGAGGTAGACGGCGTATTCAATGATGTGGTCGACCAGCGGCGGCGACAGGTATCGCCACCGAACAAGCTGTTCATCTGTAACGAATGAGCCCAT
GAAGGCTGCAAACATCCACCCCAATTGCAGCATCGCCTTCTCCTTCCAGCTAGCAATCGACGACGAGGATGCCAGTCCAGCGCTGCCAGGCGCTTGTCGC
TCTCGTCGCCGCAGCGCCAACGTGTTCGCGTACACCACGAGGCGGCACTTTTCGCGCTCTGCCGGTGGGAAGTGCCGATGCAATGCCGGACTCCACACCA
CAGCCCAGTCGGGGGACAGCATCAGCCTCACATCAGCGCGAATCCAAGATGCCATCTCCTGCCAAAGTGCGTTCGCTGCCATCACCAGTTCAAAAGAAAA
ACTCAGCACCTCATCCCAGCGCGCTATTTGCAACAATTGTCCTTACGTAGCGTTGCGCGTGAAGCCCCGTTACTCAGCAGAAGCGCAACCAACGTGTTGT
TCTTGCGGGCCATCGCAAGCGTCAATGCCGACGACCCCGTCCTAAGCTCACAGATACCACAACACACCATCATATTATTTTCAGTCTCGCGATTGTGATA
GTGTCAGGATGGCTGAGGAATTACGTGGAGGTGGCGTTCAGGTCAATGCTTTCCTCCTGTAGGAGCCGCCGCACGACTCCAATGCGACTGTGCGCCACGG
CGTAGAGCAACGCCGTCCAGCCTTCGCCCATCGTCACGTTAACGTCACCTCTTGCTCCAGTCGAGAGCCACGCGTCGACTACGATGAGATCTCCATCCGT
CGCTGCGTCCAGGAACGCGCGCTGCTTGAGGCGGCAGTCGAGCGCGCCGTCCGCCATTTACACCGCTGTGTCACTAAGCCGAGGTGCCACTAAAATCGCT
AAAAAGCAGTCGGACCAATCACTAAAATCATTAAAATGCCGTCGGACCAACTGTAAATAGATGGCTACAGTTGAGAAGGGCGCTATTCTGTTGCTTTTAC
TAGTGAAGATTGGACCGCGTTCCATGTGTACTACGACCTTGGAAAGCAGATCTCGGCACCTTCCTCTTCTTCGCGGAGCTCATCCCTGTCTCCTTCTTCG
CTCGAGCCGATTGTAAATTTCGGGACGGTCCTTTCCTTGCGGCTCGGGATCGTGGAGAGAGCGGACTTCCTGGTGGAGACGCCGGCGACGGACTGTCGTT
GTCGATAATGTCCACAATTGTCTGCATATATGCACGCGAGGTTTCTGCCGCGTCAGGGATTCGAGACCAGGCGCGCGTGCGCCACTTCGTCCACACCATG
ACGGCAAGCGCGACGCCCACTAGCGAGATCAGAATGACTTCTGCGACAAAGGCACCAAAAGCGGGGCTTGACCTCTTCGTCGCCACTCCAGTGGTTGAGC
TAGCCGCGACTTCGGGACTGCCTACTGTGTTGGCCAAAGCTGTTGCTGTTGCGTTTGATTCAGCAAACGAATTGTTGCTGGAGCTGGCGGCGGAAGAATT
CACTAAGAGTTGCGGTTCAGTCGTATCTGCGGTGATTGGTGCGGCACTTTCGGATGTTTGCTGTTCAGTATTATCTGATGCGATCGGTGTTGCGCTGCTA
TTGTTACTATAACCTTTTCCTGTGAACCGTCAAAATATCACATGGACTTAGGACTACGTAGTACGTTTCGGCATCGAGCAACAAACCCAGTGACGTACCA
CAATCAGACTCAGCAAAGCCAACACGCTTGTTCTCCGCATCAAAGATCACGTCGAAACCAACCATGGTACTCGCGCCGAGAACTGGTTTGGCGAAAAAAA
TTGTTAGTTTTGTTGCAATTGCACACACAAGAAAAGGAGACATAATCTTACCGCCACCACTGCGTTCCGAAAAGTGAAAATTGCCATAGTACGATCCGTC
GTCGTCGGATGGTGTGAGATACTGTGAGGCTGGAACATCCAGCTGAATGTCATCGGTACCATCCCCCTTCATTCCAGACAGTATAATGGAAATTGTTGGA
AGGGATGCTAACTCATCGGTGGTAAGCTTCATACTTTTCTCGTTGTACGCGCGACCCCCGGCTGCATTTTTGAACGCATTCAGGAAACTGCGCTGTCCTT
TTGCGTCGAAAAAAGTGTCGGTTGTACCGCTGTCCACAATTATGCCTCTGCCTGAATTGATCGTCCCGGCGTCAATACCAAGCGACACTCCATTTAGCCG
GATGTCCTTCACGTGGACGGGATAATACGCTGACTTGTCATCCAGCAGCGGAGTGTAGCCGACATTGCTTGTGTGATGGCTGTAATCCACTCCTCCAAAA
ACAAGTTCGCCACCATCTCCCGCAAAGCACAATGTAAAGAGGTTCTGCGTGATACGTCCAGCGCTCAGCATGTAGGACATGACAGTCGAGCGATGGCGAC
CAAGACCCATGATGCCGTTCTCCTTCTGAGTGATGAAGAGACCAGTCTCTTTAGTCTGGCAGCCCACTGGGAATCGAAACCCGAACGTCTTCAGTACTCC
CTCCACCTCGTCATCTTTTGAGGAGAATCCTCCGACCCACACCAACTCGTCCACCATGACGGCCTGCCACATGCTACCCTCCATATAACTCTGTTCAAAT
GACAAACACAACATAAGAAGCAGTCCAGAAACCAATTCAAGAAGAAGGCGCATCAATACCTGGGAGATATAGCAGCGGTTTTGCTCACACGACCGACAAG
AATCAAAATCATGGCATCCCAGATACTTGGCCGTCGTCGACTTGGACACATCAAAAAGAGGGTCCGTGTGCGTCCCGCAGCCGTCACAAGTGCTGCACGG
CAACGCCGTCAAGTGGCTACCCGTGTCCACAATCACAGACGCTCGTTGCGCTGGAATCCCCAAGTAAATTTCAGCATAGTGAGTACTACAGTGCACAAAA
GCAAAAATCAGTTGAGAAGCCACTACTCTCGCAACCTGTTCGTACTCACCCTAAGCCTACACCCAATGGAGCTTCACTCAGAGCTAATGTCCCCAGTGTA
AAGTCTCCGTCCGCGTTCCCAGTCTCCTCCTGTGCTCGCCTCCGCGCTCGCTCCTGCTGCGTCGCCAATCGATAGGCCAGGTCTGCACTCGGCTGCTGCT
GCTTGTGCAGCTGAATTTTCAGGAAACTCTGTTTGCCGGCGGCAAGAGATGTCATTTGAGTGTACGCTACTGCTGCAAAGACTGCCAGAGACGCTCGCCA
CCGAGCGCCAGCAGCTCCGCTTCGAGACGTCATCGTCAATAACCCGAGTGAGGGCTTCGGCAGTTATAGCGGATCTATTTATAGCCAATGAAA