Description :
From Genome Similarity Track
Location :
Scaffold_272:17895- 20827
Sequence
2932 bases(100 bases per row)
TATTCAAATTCTTATACAACAAGCTACCCCATCTTCTGGTGTGTGCGATTTCGTAGCAAACCGTCTACCCTATCCTTTAGAATGTTTTAACTCCTAAGAT
ATTTCAATCCCATTCTTCGTGCTATCTTCTATTACGTTCATCAACTCAACGCCATGGGTCATCCGATTTGATTTCTTGAACTGCATCACTTCGAGCGGTT
CCAACGCACACGATCTCGTTTAAAATCTTGTAGAAGAGCTCCGCAGATTGGATCAGCCTCATATACCCAATTCAAATCTAAATACTATTCCATTTCTCTA
AGCAGTGACAATGAATCCACCCATAGCGAGTTTCTGGGATAAAATGACACATCCATCATCATACACTACAAAACCTCCTTCCTCAAGATCTCCTTCCAAG
AAATCTTCAGGAAGTAGATCCGATTGAAATATTGACACGATCTTTTCATCCACCACTATCTTGTCTTTGGGTCTTTCTACAAAAAATCTGAATTGTTTTA
GCATTATAAGATGTATGATCGTAAATACTCGATATAAGGTATCGGTGATCTCCAATCGTACTGCGTGGTCACCACATATTTACTCCACTTGATAAGGTCC
GTGTCAAATCTGCGCTCTCTTCCTCGCATCTATTTCTTAAACTCTTTACAGATACGTACACATTGGTGAGTCCTTTCAGATCATGTGGCTTCAGAGAGTC
ATTGTTGCCTATCCTGCTCGTTCTTGGATCTCGGCCCGTAAGTCTTTATTAACCGCAGACCGGGATTGCTAATATTGCCTATGGATATGATACTGCCACT
TCCTTGGATCGCAATCATACGCTTTCGTAATTCTCACCGATATTGTCGCTTCCCTCATAGATCGTGGATCCAATGCATGAATCAGAATGCATTAATCAGG
TTAGGTATATATCCTCGAATCTGATCTTGTTTAGTGTTGACTGCAGAGGTAAGACGCTCTGCTTATCTGTCTCAATTCTTCTGGTTGACATCCGCGAAGA
TCATCTTCAGCGAACGCGTTAAGGTTTGGACTATACATGTAACCGTTTGCTTGCTTGAATCCGGTCTTATCGAAGCTGTTTGTCTCTTCTCCACAATTTG
GTGGAAAGCACGAAACAAATTCGACATTGATCAACACTCTTAATCGTGTCGTACAGCTTCACTCACGTCTGAGGGCGGAACACACAATCTTCGTAGTTTG
ATGCATTTTTTTGCATCCAGGATGAGCTACCTTCCGCGATGACATATTCTGAGAAGTAATAGATCCAAATGAGTTGCTCTGTATTGACATTGAATGACTT
GGGTAATGACGGGATGTGATCCATAGATCTAGAAAGGATATGTCGCTTGATACTTACCAGACGATTTTTGTTCGATCGTTGTACAGTCCTACTTAGTCTT
ACAGTCCTTACATTCACCCATCTAAGGACTGTGAGACCGGATAGAGCGTTGTACAATTTAATACTGCCCTCTCCAGTTGAATTGCATCTGATCCGCTGTA
ATTTCTGGACGAAGCTGTTCTAAAAGACAAGAAATTGACACTCAGTGCGCGTAGTGGATCATCTATACTGAAGAATCCTCGCGATACCTTTTATCTTTTG
GTCAAGGATTTTATAAAACGTGGTGTTTCACGACCCACCCTCTGTTTTATCTTCAGATAGAGTGTCCGTCATGAAATTGACGATGTTACTGGGACCAATT
ATGGTGTCACACGACAGTCGCCCTTGCCAAAGGAAAAATGTGATGTCATGACTTCTTCCGTACCAAGCATGAGGCAGGAATGGTACGTGAGAGCAAATCT
ATACATTCGACACCGAGATTTTATGTCAAAAAGCCGAATGACAAGTGGCGTATTGCGCATGCTTATAACAAGCTTAATGCGGCCACTATTCCGGCACAGA
CAACCATTCCTCGAAAGGATGTTCTCTAACACAAAATGGTTGGTTTTACTATGTACAGCGCACTCGACTTAGTCGATGGATATTATCAACTGCTCATGCG
AGCGAGTGATATTCCGCTTACAGCAGTGAGCAATCCGAGTGGTATGCTATGGGAATGGCTGGTGATGCCCCAAGGGCTGTCTAATGCTCCGGCTACATTC
AATCGTCTGGTAAGGCAACTATTCTCCCACATCGGGATTACGCACAGACGTACTTTGATGACATTTTTGTCCATAGTCGTGCTGTACAAGGTCAGTCAGA
TGTTGACAATCACATTGGTCATTTGCGAGCTGTGCTCGAGTGCATGCGCACGAATAAATTTACGCCAACGTGTCTAAATGCATTTTTGGTGCAGAAGAGA
TTCCTTTTCTAGTCTTTTCCATTGGTAAGAGCGGCCTCAGAGCGGATCCCGCTAAGGTCAAGCCGATAGTGGACTGGTCGATTACTAAGAGTCAAAAGGA
CTTGCGTAATTGGCTTGGCCTTGCCAATTACTTGCACAAATACAGTGAAAATCACGCTGATATGGATCGCCCATTAACTGATCTCCTTAAGAAGGTTACG
GACTGGTACTGGGGAAAGACCCATGATGACGCATTTCGGGCGGTAAAGGTGGGTCTCCTCCATGCTTCCATTTTGGCCTTGCCAAATCTGGAGTACCCTT
TTAGTGTTGTCTGCGATGCATCCGACTTTGCCATCGGCAGCGCTCTGTTACAAACAAATGCTGCAGGCCGTGAGAGAGTTATCGCATTTGAATCTCGTCA
TCTGAAAGCTGCTGAGAAAAACTGTCCCGTTAATATCAAAGCGTTACTTGCTATGAAGTATGCTCTCGTCAAATTTGGAGTTCACCTGCTTGACACCTAG
TCATTTCTCGTCCAAACGGATTATGCATCGTTCCGCACGGCGACACGATCGCCTCACCGCTCTCAGAGAATAAATTTTTGGCTTTCCTTCTTTGTGGAAT
ATAACTTCGTGGTGAAGTATAAGCTAGGCAAA