Description :
From Genome Similarity Track
Location :
Scaffold_52:178940- 182619
Transcript NameFunction/comments
g18261.t1RAW28074.1 hypothetical protein PC110_g15541 [Phytophthora cactorum
g18262.t1hypothetical protein

Sequence
3679 bases(100 bases per row)
ACATGTTGGTGGAGGAAGAGGAGTTTGCATTGCGGGCGGAAGCTGAAAATGCGAGTCTGCAACCGACGTACATTGCGTTGAATCAGCAACGGAGTGCCCA
GGAACTGGTGTCGACTCTGCCGGAGATTGTGAGCAAGTATCGGCGCGGACACAATGAGGGTCGTCGATATGTGGAGGAGGAAGATGAAGAGGACTGGATG
GATCTGTTTGACGGGTGCGTACTGTATCTGCTGGGGTTCTCGCCACAGATGAAGACGCTGCTCCAGCGTTTGATACGGACTGGCATGGGAACGATATATC
ATAATGTGGTGATACGCCAAGTGACGCATGTAGTCGTGAGCGCGTCGCTGTCGGATCGGCAAACACTTGAGGCTATTCAATCTCGCGTCATAACTGCCGG
TGCTGAGGGCGAGGTGTACTTCGTGTCAGCGAGCTGGCTGCTTGACTGTGTCAGGTGTCAGGATCTACAGCCAGAGGAGCTGTATCCAGTTGAGTTTGAT
GTGCATGCTCCGGAACCCGTACCAGGTACTGGTGCCGACGCTCTTCATCTCGAAGGTAGTGTGGGTGTCAGTATCCCTCAGGCTCCCATCGAGTACAAGC
AAGTTGAAGCTGATGCTGAAGCAAGCCTAGAAGCAGTCACTCTCTCGGAAGATCTTTTGCAAGATGGTGATGGGAGAAGCATTTTGGCAACCCGTGGCCA
AGCAAATCTCTCTCCGAGGAAGAAGAGGACGAATATCTTTGCCGGCTACTCGTTCTTACTGCTGTGCCGGGATCCTGAGGACAAACACTTGATCAAGCCA
ATGCTCCAGAGCCTTCGAGGAGAGCTCGGAGGCGCCGAGGCTATCGCGCTCGAGGCAATTGATTTCCCCCTCATTGATCCAAAGCAGTTCGCATTCGTGA
GTCATGCGGTTGTGTGCACTGGTGCATTGATGGACCAGCGGGCAGCACTGGAAATACAGCAACGCATTCACGATATTCAGCGCAACAACCGCGACAATGG
TGCTGACCAAGAGGCCGATGCAGATCTCGATGACAGGCCTGTGAAGCGGACACGACACGACCTAGACGATGATCGACAGAAGCCTCGGCAGCGAATGCTG
CAGTTCGTGTCAGATTTGTGGGTAAACTGCTCTCTTGCTGCCAGGACGAAGCTGTCGTTTACCTCACACGAACTATTCGGAGTCAGCGCCAACCAACCGC
GCGCTCTGTTCACTGCAGCGGTACCGCTATCTGGCTTCCAAGACGTGAAAGTCTCTACCTCTGTATATCGGGACGTGGAGCAGCTTGTTGTGGCGGAGCT
ACTACGAGTTGCTGGCGCGCACGTGACCAGAAAGATGAGCGAACACAACACGCACCTGGTTTGTCGAATACCTCACGGAATGAAGTATGTCAAGGCCATG
GAGTGGGGACTGCACGTAGTGAAAGCCCGCTGGGTAGTCGATAGCCTTCTGCAAGGCACGCGGCTCAGCGAGCATAACCCGGATTTCCAAGTTGCCGACG
AAGATGAACCCAATTTTGCTCAGACGGCGAGTCAAGAGACTGCGCTGTCACAGTCGTCTCCACGCTCGTGAAATGAATACGGTACCGATAAGCACGGAGC
GCAAGCGTAAACTGTGAGTACGTGTTTGCGTTGAATTTATTTACTCCTCGCTCCTGTCACGATGAAGCTTACTCTCAAACTTGACCATGCTGGAATGAAT
GGCTTCTGGCATAGACTGGAGTGATGATCGCGTGCATCTCGAAGTCATTGCTTAGGCGTCGCTCTCGGCCAGCGAGTCGGTGGTTCCTCTTCTTGAACAG
GGCGACACCAGCGATGGCTGCGACAGCACCGACAGCAACGACAACGGCGATCAAAACAGTGCTGGAAGCGCCACTGGTGCTCAGACTCGCATCATTTGTC
GACGTCGTCGTGGCGAAGTAAGAAACGGTACTTGCGTATGTTGGCGAGGTGGTGGTTGACGATTGCGTCGGTTCCGTAGGTGATGGCGTTGTGGTCTGTG
AGGCAGGTGATGATCCTGTCGAAGTAGTTGGTTGCAGCGTCACTGGATCCGTCGTGGTTGGGCAAGGGGTGGTCGGAGACAGCGTCGTGGGCTCCGTCGT
GCTTGGACACGGAGTTGTTGGAGACAGAGTCGTTGGCCCCGGTGTAGCAGGCTCGGTCGTACTTGGACACGGAGTCGTTGGGTTTGGGGTCGTGGGCTCT
GTTGTACTAGGACACGGAGTCGTTGGAGACAGAGTCGTTGGGTCCGTCGTGCTTGGACACGGAGTCGTTGGGTTTGGGGTCGTGGGCTCGGTCGTACTTG
GACACGGAGTCGTTGGGTTTGGCGTCGTGGGCTCTGTTGTACTAGGACACGGAGTCGTTGGAGACAGAGTCGTTGGCTCCGTCGTACTTGGACACGGGGT
CGTTGGAGACAGAGTCGTTGGCCCCGGTGTAGCAGGCTCCGTCGTGCTTGGACACGGAGTCGTTGGGTTTGGGGTCGTGGGCTCGGTCGTACTTGGACAC
GGAGTCGTTGGGTTTGGCGTCGTGGGCTCCGTCGTACTTGGACACGGGGTAGTTGGAGACAGAGTCGTTGGCCCCGGTGTAGCAGGCTCCGTCGTGCTTG
GACACGGAGTCGTTGGGTTTGGCGTCGTGGGCTCTGTTGTGCTAGGACACGGGGTCGTTGGGCCAGGTGTAACTGGCTCCGTCGTGCTTGGATATGGCGT
CGCAGGTTCTGTTGAATTGGGAATCGGTGTCGAGGCTGTCGGCGCATCCGTCTCCGGGGCCTGGGTGGTCGGAGCGGGCGTAGTGGGGCTCGGCGTGGCC
GGTTCTGTCGTATTTGGCAGCGGCGCGTGCGTGGTCGGCTCTGGTGTTGCCGTCGTTGGTTCTGGTGTGGCAGGCTTTGCTGTCGTTGGGACCGGCGTCA
CCGGCGCCGCAGTGGTCGGCTCTGGTGTTGCCGTCGTTGGTTCTGGTGTGACAGGCTTTGCTGTCGTTGGGGCCGGCGTCACCGGCGCCGCAGTGGTCGG
CTCCGGTGTACTGGGCACTGTCGTCTCCGACACCAAAGCCGCTGTCGTCGGCGCTGCCGTTGGCGCCTCAGTGGTGGGCGTCGCCGCTGTCGGTGCCGTT
GTCGGTGCCGCTGTAGGCTTCTCTCCGCAGTCGTACATCTCCCTCAAGGCCGTCGTCTGCACGAACCAGCTCTCGTCGTACTCGTCGTTGCCGTCGAACG
AGTAGCTGGTGTCGATGTCCACGGCCTCGTCGGCCCCGTTCACGTCCCACGTAGCGCAGTCCGGCGCAACCGGCTGCCCGCAGCCGACGGACGGCAGCAC
GCAGCCCCACGTCGTGTCCGTGACGATCCGACACTCGGCGTCCTCGGGCGCCACGCAGCCGTCGCCTTGGAACGACGGCAGGTACGCGCGGCACTCGGCC
ACGGCCACGTCCCCTTTCAACGGGCACGCGGTACCCATCGGCGCGTCTCCGGCGCCCGCGCACTCCACGCCGCGACTCGCCGCCAAGTCGTATGTGGCGT
CAGCGCACACGCTCACTTCAACCGCCCGCACGTCTCTAGAGGCGAGGGCCAGCAGCAGCCACAGCAGAGGCGGCGACCGCATTAGTATCCGATACATCGT
CCGCTTCTCTCCGAGGCGGGGGGTTCAAGACTGCAACACGCGGGAAAAGGTTGGCTACGGACCTTACGTCGTGGTGACC