Description :
From Genome Similarity Track
Location :
Scaffold_113:17894- 19293
Sequence
1399 bases(100 bases per row)
TGCACGACCACAAATTACTAAATGGACGCCTTTTAAAAAGTATTAATAATTGTTGTTAAATGCACAGCCATTTATCGAGATAAGTTTTGCTCGTCAACGC
TTGCATATCAGGCGATAGTCTTGTCGTCAATCATACGGCCTACGGACTGGTTAAATTAAACAGGAAGAACTATCTATATTTATCATCTTGTGCCGAAAGC
CACTGATGAGAAGAACAAGGTGGTCTATGCCTACAAGAAAAAGCCATCCAAGAATGAAAGAAAAAGACAGTAAGAGAAGTAGAGACAATATAGGACTTGG
AGCCTTGAAGCGATTGGAGTCTCTCTAGAGGACACCACCGCCTTAATATTCAGTTCCTACAAGAGCTATTTTTGTTTAGACGTCGTGCGGCCGCATGATC
GGCTATATCGAGGATGATTAAATAAATAAGCTCTCCATTTTAACTGTTAGGTGCCAAAGGCCACCCTCTTTGACCCTAGCATACAGCTGGGACTTACAGA
TGAAGATCTTAGTGACACCTTTATGCTTGTGCTTTTTTCTTACACCCGACATGGTGTTCCGCCACGATCGCACTTCAACCCATTCTTGCAGCCTCCAGTA
GATTTCGAAACTGTAACGGCGTACTTTCAAGTGCGAGTAAAAGCACCCATAAGGGAACCAAGATGCTAGTAGGTGTCATAGGCCCAATCTGGTGGGGTGA
TCGCGCACTTACTTAAAATCAAGAATTCTCTGTTATCTGCTTTGCAACCTCTTACATTTGTGTTACTCCCTGGCATTAAATATAAGCCAGCGGTCGGTCA
CGTTAGATATAAATAAGCGTTCATTGCACAAGGCGTCCGTCGAAAGTTTTGAATTTCCTGGCTGCAAATATGAGCCAATCGTCGGTCAAGTTAGCCAAAA
ACGTTGTACAATCAACAAAGCGTCCATTTAACAATTTTAAGGCGTGCATTTAACAATTCCCTAATTTTATTAGATTTATTTTCTTGTATTATTTTTTCAT
GTAGGTTTTCCTTTCGTTATAAAAAAGGGAATTGCTAAATTCACACCCCTTTTCCTTAAATTCACTCTCTTTCTTATATATCTTATATATTCAAATCCTA
TTCATTTTAAGAATTGTTTTCTGACAAAGGTATTTACTCGATAATCTTTGCCATTAATGGACAAGTAATGCGTAAGATATACCTTACATACTACTCACGC
CTGTGTTCTAGCTCCTCCGGTGTTTTCTGGTACGGAGCCATGCAATAACATGATTCCTCCTCAGTAGGTGCGGCTGTTTCTACTGCGGCTATTCCTGCAT
CATCTCCTCCAGCAAAGACTTTGAAGCCAGCTGGGTATATGAAGACCGCACCTGCATCGAGTCCGGCAGGTGTGATTGGTGAAAATCGACTTCGCCGAA