Description :
From Genome Similarity Track
Location :
scaffold_17:178884- 187652
Transcript NameFunction/comments
Plaha_PHALS_11096Phosphatidylinositol kinase (PIK-L4)

Sequence
8768 bases(100 bases per row)
CTCTGCGTTGCTTTACCGCGACGACCCCACTCGACAAGAGGGTCATGAATAAATGATTCGAGCACGCTGCGCAACGTAGCCTTGTTTTCTCGCAGCAACT
TCATTGTCACCTCACTTACTCGTCGAAACACACCCTCATATCCCGTGATACCAAAGGCATCAATGATATTTGGCGTCAAGCGAAATGGTACAATTTCAGG
CTTTGTTAGCTTGAGACCTTTGTCAAAAAGGCAGTCAAAATCTACGTGAACGCACTCGCCGTTCGTGCAGTCGATCAAGATGTTTTCTCCGTGACGATCA
CCAAGCCCGATTATATGTCCCACCATGGACCAAACGGCTGCAGAGCGCGAAAACGCGAGTCGAGCTTCGAACCATGCAGTTGGGTCGGCGAAGTTATTGT
AAAACCATTGGTGAAATCTGGGCGTAAAACCTGGCAATGACAACACATCATTGCGGTAACATCGCGCCATAGCGGGAAAGTCGTTCGcatatttcttctg
catatTAAGATAGTGCTCCTTAATTTCATGCGTCAGGCGAACTGGCTGTATATACCCGCGTTCGGTCTTATGGATCTGTCCGATTAGCTGCCGCATAGCC
TTTGTGTGACGCACCCATTCCATCAATCCGCTCTCTTCGTTTAAGCACACCACAGCGTACGTACGCAACCGCAGTTTGCGCTTGCGCCCttcttgatctt
tctgaAGAAGTTTGTTGATCATTGAGTTAAATTCCATCATACGCGCGTCCTTGCGAAGATCGCCGTTTTTCTCACGCTTGCACAAAAATGGATACAATTG
ACCATCGGTTCCAAGAATTTCGATGCGCTTAGGCTTTTCCTTCGTCATCATTACATCAGCTTTGTCGCTAAAAGCTTTTATGTAAATCTGCGCACTAGAT
GAGAAAGCAACATGAGTTTCGTCTGGGGGAGCAAGCCCAGATGTCGGCAAAATCGTTGTCAGAGTCGTCTGAATCGgaatcaaaattttggttCGAATTC
GGCTCAATCTGATATGAATCTTGCGCGTTTTGTTGCCGGGATCATGAGCAGCCAAGCTGATGAGCTCTTCGGCCATTTTGATTCCCTCAGAATAACTATC
TGCACTTTCCGTCAGCCCATTCGTGAGAAATTGCTGTTGTGCGCTTGCAATGATCTCTCGTGCACGATTTCGACGTTGAGGATTCAATGAACGTGCTAGA
CCTAGCAGAGACCACATTGACTGCGCTGGATAGGTAAGAATTACTTTGAtcataatttttttgacaCAATCAACCACAACTGGATTTGGGTGACAGATGC
GCGATGTGACTTGAGGAAAACACACCAGCCATTCATAACCGGGCAAAGAGTCAACTGCTTCATTCACAACGCTGGTGATGTCATTAAGAACCCGCTGCTC
ATTAGTGGACTGACTGAGCCCGATCTCGATCTGCCTCATGGCCTTGTTTGCTATGCTGCCCACTCGCCCACTACTGCTTCCGTAAAGCACTTCGCCATAA
TCAAACCACAGTGTCAACAATCGTGGAAGAGACTGAAATACGAATTTAGTTCCATGTGCTAGTGCCAATACATAATTTTTCATCAGACTGATCAAATAAG
CGTGAAATACTGAATCGACGAGAAGATCAGCTGCTTCGTCGCTACTCATTGAGCCGTTTAAGGCATCCGGGTGGCTGACATTTAACAAATATTCGTAGTA
CTTTGCTAGGAAAAAATACCCTTTCTCCCACTTCGGATCAAATCGAATAACAGCCTGGTATCGCTCGATAACCTTTTTACCTTGACGTTGGCCTGACTCC
TGCATCCAATTAGTCGCCAAAAGCAGATTCTTAGCGCAAAGGTGACGGTCATCAACATTAAAGTCCAACATGGACGCGTCGATATCAACTGGCTCGAGGA
TTTGCAACGCCTCGTACAATCGGTCTTGGCTCACAagcaattttgctttttctgTCAATGCATGCTGATTGCTCATTGCATGAGCATGCATCACAGCGCT
GGTGGCTGTTCGAAAAAAACCTTCTTTTCTCGCTAACTTGGAGTAAACCAGCCAATTTTGTGAAACTTCATCTTGTAGCCCAATCTCGAGCAAAATTACT
CGGCGTAGTGCGAGAATAGGATCGCGGTACTTGAGTTGTGTTGCCATCGCATCATAGCGCACTTTCCAGGGAGTTTGCGTTTTCCAGACAAGACCACGCC
GAGTTGAATCGTCAAGTATTTTTGCTCTTTGTATAGCTATATATCCTTGCTCTGCCTCGTGAAGAAAGTGAAGATCATGCAGAAAAGGATAAGCGCGCTG
GTACGACTCAGCCGATGCCGCTGCAAGTGGACCCATTACTTCTAGCCGCGCTGCCTTTAAGTGGCGCTGAAATTCTATCTGCTGGCCACTATGCAAGCTA
TGAAGTACACGAACTAGCATAAAATGCGAAACGTCGAAGCCATTGCTGACAGGATCACTTAAAAAGCTTGTTGAGGAGTGAAGAAGCGGGTTTTGTTTCT
CAGCACTCAGTAAATTTGCTAACAAATCCCATCGCGATAAGCGCCAGGAACATTCGAGTGCAAATGGATACATTCTAGCCATAAATTGAGGTTCTTGCGC
CACAATGCCATTGATATGCTGTAATGCAGTTTCCAGGCGTCCGAGTTGGATAAGGCATCCAATCATACCCGCATATAGTGTTGGTTTAATCTGATCTGGG
TCTTTAAGTGCGTATTCCGGAGGTTGCATCATAGCGAGCTGACTATTCGATTTCGTGCTCAACGGTAATGTTCTGAATGATAAAGCTGATTGGATTTCCT
GAATCGCTTGCTCATAGCAAGCTAGGGCGTCTTCCCATTGAGCAAGCTGCTCATAATCGACAATTTCATGCATTAAGTCAGTGAGGTTCAAGTTTCCTTC
CTggacgtttgagtgcatgtCTGTTACAATATCGCTGTGCTGATAAGCATCATATAAGCGGCGCAACGAAGCTAGTCCGACCAGTAAATCAGGTTCGTCT
ACACTTTTGTACAGCTGCTGAAGGTAAGTAGCGTTTTTGGAAATCAGAGAAAGCCGGACGGGGCCAGCCAATTCAAAATCGGAAGTCTTCATTTCTGTTA
ATTTGAATTCTTCCTGGCGTAAATAAATTTCAAAGTATTGAACTGCACGAGCATAAGCTTTTATTCGGTATGCAGCGTTTGAAAGAGATCGGCTAGGGAT
TTCTTTCACAAATTCTTCAAGATATTCCTTTTCGTGATCATCGTCGACTTCAGAGGCCGCCTCACTGCGACCAGAAGCAAACGTTTGGCGACTTGCAACA
CTATTGTTTATTCCGAGCTGCTTCTTTTCGCTAGTCCAAATCCAATCGTTCATTTCATCAATAGTCGAGAAGATGGTCTGTGCACATTGGTCATGTCGTC
GAAAAAATTCGCCTGTGCCTGTATCAGTCGTGCCCCTGGCGCTGGTGAGTGGGTCGGTGGTGTGTGCAAATCCAGGCGGTGCCATTATAACATCATCTCT
GTAACCACCACTATCTTGCTCATTCAGAACTGCCATCACTTCTCTTTTGAGCTCTTTCCCAACCTCAGCTTTTCCCGAGCGAAGAACATTTTGAATCAGG
TAAGGAAGCAAAAATCGAGAAATTTGTGGGCACGTCGAAAGTGCCGTCCTACAAGCCCGAAATATCTTTCTCTCGGGAGGCTGAGAAAGGTGAATTAATC
GACGGCACCAATTAAGTATCCACTCTTCGTACGAATTgccaaatttttcaaaaaacaaAACACCTTCCGGTGCTAGattatttttttcatcagCGCTAGC
GAACGTTCGACCCTGTGATTTGCTGTCATTGCGGTGCGAGGATCGGCCTCCTAATACGGCATAATTTGTAGTCCAATAGGGCTCCACAAACTGAAGGACG
CCTTTCCGTTCAAACCGTCTCTTCATCCATTCGGGCATTGCATCTTGTCGCGATATGTGTGACGAGCCTAACGTCAAGTTTTGACCAACGTGCTGTGGAT
CAGCTGTGAGCTCGGCTAAAAATTTTAGTAGCTCCTGAATAGCAAAAGCTACCGAATCCGTATTTTCAGGAGCTGCGCGTAATTCGTTTACCAGCCATGT
CTCAATCAGCACACAAGCAAGATCTTTCGTAGATAACTCAATCTTTTGGTACTGCCTTTCTTTTGTTACTACACCGCTACCTTGATGTCTAGACGTATAG
AACATATTAAGCGGTACTCGAGCTCCATCGATTGCACCTAGAGCTCCCAAGCATCGAGCGCACAGCAATTTGTTAGGCTCGTAAGTCTCTGTGCGAGAAA
GCTGCATGATTGACtgcactacacaagctaatGCTTTGTCGATAAATATGTCACCTTCATTCTGCATCAGGGCCTCGAGCTCAGCGCCACGGACGACCAA
ACAGCGCAGCAAATGTACAAGAGCTATTTCACGAACGGCTACATCAAGATGATTCACGTATGCCGACAGATTCATCAAATACTCCCGGATAGGCCGACAG
CTGGGATCTCCATATTCTTTATAGAGGACTACGTAAATCTCGTCTAGTTCTGGTATAGATGGCAGCAACGGGATCGTTGGAAACGAGTTTTTTAATTCGT
CTCCCTTCTCGATAAACAGATAGCGAAGGATATCCACTGCTGGTACCATGCATTCCATCCGTGCCTTGTCACGGTTGACAGTTAAGTCAGCTTGTCTAAG
AGGTTCGTTCTCTATCTGCTCCAGAGATTCAATATTCCAATATCTACTACCAGCTGAAGATTCGTCTTCAGTGAGTATCGCCGAAGCTCCATGGCCGAGA
CATGGAAGCAAGCTCACAATTATGGACCCCAAGTTTGCTTCTAGCGCTTTTGTTGACAGCATGCGCAAAAACTTTCCCCACGCCAAAATTGCATGTTGTC
TCAGGTGCTGTTCTATCAAACCAACTTTGAGGGTCGCCATCACTTTAGGGACAAAAGAATCGACGGCTCCATAGATAGGTGATTTAACCCCGTCTGAGTT
AGAGCCGCTGTGAAGTTCAAATAAACAGTCAATACTTTTTATCGCACGAATTTTGaaagaagatgaaaagtTGCCACTGATACGATTGCCTAAATCTGTC
ATTAAAGCCAGAAAAAAATGGCAGGGCATGCACGCTTGACCTAGTCGAAGGTTCGCAACTTGTTCGATCGTTTCTGTTTCTCGCGAGTCTTCAACAAGGC
AGTTTGCCACTTCTCGAATCGCTCGCTTGGCCATACGAGATTGAGGTCCACCAAGCTCCCACGCTAGTAAATTCATTAGCCGCAGCGGAGAGTAGGTAAT
TACATCGCGGATGGTCGAGTTCTCTGGCAAATATTTAAGCAAAAACTCCCACTCCGCTAGACGATTTTCATTCGAGACTGCTTGCACTTGATGAATCAGT
AAATCTTTCAATACATGATCAAGGTAGCTCAGGAGGAGATTGGTGATACTCATCGGCTGGTCAATTGCATTCTCGCCTGCGATTCTAATCTCGTCACCTG
TCCCATTGAATTCGTGTAGAAACGAATGCAACATCTGCTCATTTTGGTGGACAACAAATTTTGGCAAAACGTACGGTGCACTAGCTTTCAAAAATATCTT
TATGTCCACTTCGCTCATAAATGTTCGAATAAACAAGCCTAGTGTTTTACTTTCCAGAAGTTCGTCCACGAGACCAAAATAGAGCAGCTCAGGAAATTTT
GTGCACAATTGTCGCCATGATACTTGATGGTGCGTCGTAATACGAGAAATTTGAGTATGAGCCGCCACTGCGCATTGTACACGATTAGCAACCGTAAATC
GACTCCATAAAGACACGAGGCGCAATATAATCCATGCGCAACTATGTCCGCGATCACCATGGTGCAAGTCACATTCACAACCAATTAATCCAGCTGTCAA
CATCATGACAGTAATTGCACCTCTATCATTACTATCTTCGGCAGCCGTCAAAGAGGCCTCTAACCTCTCCACTACTCCAGCGAGACCATCTTTCTTTGGA
TCTATCATTGCATCAAGAAGGCGTGGTCGATCAATCAGCGATCTTAGCacagcatggcggacgcgcTCAGAACGATGTTCAAAGCACGTCAAAAGATACT
CCACAAATCGTAGGGCAGTCGAATCACGCTCATAATCGACCTCACAGTGCTCCAAAATGCTTGACAATGCGCAGATATTTATAATGTGCATACGTTCGGT
AGCATTGCTTACATCATCGCAAATAAGTGGCCTAAATAAGGATAATGGGACTGGCAACTCTAGGCAACCCTGAGACCTTTTCCGGCATTGACAGCCAGCA
TTACAGCCGCTTATATATTTGTTGTTAGAATAGCTTACCCCCTCAGCAAAAGCCTGACCAAAAGACGCGGCACAAAGCATTGCCCCACACGCTTGCGTTA
GTGAAGATGAAATAATAGCTGACGGTCTTCGCTGTATTTTGCTACTTAACATTTCTGTAATGCAAGTGGTCAAAGTTTTTGGAGACGTCAGCGATCCAGC
CACGACAAAGAAGGCTAAAATCGGAATCATAGCAAGGTAAGAACATACTTTCACATCGAGTGACGAATCTTGTGATATCGTTTGGTAAACAATTTTCCAT
GGTATAACACTGCGCCAGGAATCATTGTCTATGATATTGAGCGTTACAGGACGCGACCAAACGTAAAACACCAAAAAAGATCCACGCAGAGCCACAGACT
TCTGAAACACAGCGTCGAGTACCACGTCGGCGTTATAAAGACAATTGTCCGAGCAATTTTCCAGCACCTCTGACGGGGACGTGTCGTGATGCTGCTGata
caatttcaaaaaaTCCACGTACTCCCAGCACTCTGGTACAGCGAAGGATTTATCCCGTTCAAAGCTACGAGTGAAATAGTCTTGTGTTTCTACACTCTCC
AATATTTTAAAAAGCAAATCTCGATGTTGTTTTATCTCATGATCATCAAGATATCGCAGCAAGATGATCCACAAATCCAGATATTCACTTGTAAGAGCGG
CGAGTGACGGAGCATAAGTGTTCATTATCAAAGTAATACGCTCAAGGAGGACTTGAAAAATACCCAGTCCCTCTAGCCGAGCAGATGCAGCGATACGGTG
ACGAAAGGGCATCATTATTCGCAAAACAGTACAAAGTCCCATGATGGTCGTCCGACCATTGTCACTCTCACCTTCAACGAAAATCAGGTCAAGTATCCAT
TGACCTAATTTTGTGTCAAGATCGAATTTGTCTTCACGTTCGCAATTCGGTCCACCCTCGGCCATCATACTTCGCTTTCGTTTTTTTGAAGTCCTAGCGA
CTTGATTTGAGAATAACATAGTCGGCCGGTCACTGATCAGATACTTGGACATAAAACTTACTACTTTAATCAGTAGCTCTTTAGACGTCAATAAGTGATG
GATGCTTCTGATGACGCTTGATACAACTGCTGCGTTGAAAAAATTTATACCGACGCACTCTAATAAATCAACGAACAGAATAGCAGGAGTTATAGTATTG
GACTGACGAATGCAAATGCTTAAGATTGAAAGCGCTGCCATCCAAATACTTTTAACTCTTGGTTTGCTTTTACGATTTGCTTTCTCGATCAGATACATAT
TCGCACCAATCCACGACTTGAAAGGACCCCATAAAGCATGAATGGCAAAATTTGAGAGATGAGAGAAAGTTTCGGCAATAAGCTCAAAGATGGCGGCATA
CGAGTTCACTGTCCGTGAATTTGCCCCGCGAAGAAAGCCAGTCTTGAAAAACAACGACACAAAGCGGATATAGCGTCTTTCTGCGGATACGCTGACCTGC
AATATTGTGTATAGCAAATTTAGAATACTGGGATGAATTGTGCTGGCGTCTTCAACCAAAATGGAACGATTCGGACTCAATTCATCACCGCCTTTCTTTA
CATTTTCGTTGTTGCTCAAAAATAATTCCTCTAGTTGACATATTTTGTCGAAGGACTGATCCCCTACAAGCAAGGCGTTGTGCTGGCGAATTATCCGATC
CGCAAGATTTATTATCGATTGCCGAAGAGCGAATACCATTTGACCCGAACTGACATGGATGGACGGTAGCATCCGCTTTAATTGATCCGTACGGTCCTGA
AGCTGGCTACTATCTGTTATGGCTATGCAGCCACACAACGTAACATTGGTTTTCGCGCCTAAGGGCCCATCCGCGTCCTGGTATACGTGAATAGCCGTAT
TTAAGTAACATGAAATCTTCAGTGGGAACACTTCAGCAGAATTTCCGCTTATTAGCGACTCTTCTAATAAAAAACAATCCTCCAATAACTGAACTGTATC
ACGGAAAAAATGCATGAACCCATACACATCATTTCTCTGCAAGAATTGCACCATTTGAAGTATTACGTTTCGCACATCGCGTTGGGCTTGTTGAAGGTTT
TCATTTGTATAAAATGAAATCATGTAGAAGAGCATAGTGGCCATCGTTGGGTAAGAAGGAAAACCTGAGGATGTGGAATTGTGCAAGCCTGTGGTGGTGC
TTTCCATAAAGATTGTCATCGAATGCGGGCACGCACTGCCACTGAGCAAAAGAGATAATATCTGACACAATCCTTGTAGCATCGTCACAGCTTTTTCCGT
CGACAATGTTGCCACGGGTCGCATGAGCTTCGGTAACAACTTGCGCAGCTTTGTCAACATAATTTTGCAGCAGCGAATGGAGACGGCAGCACTCGAGTCA
TAAGCATCGTCTTCATGTTGGTGCTGATGAGCACGTACAAGTTGCAATAGGCTTTCTACGTCGCTCTT