Description :
From Genome Similarity Track
Location :
Scaffold_440:17887- 19443
Sequence
1556 bases(100 bases per row)
GAGCGGCCCATGTACTGTGTGTCAAAGAATGGCATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCTCGATCGTGGCTGGATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCAC
GTTCACAGGGACTTCCTGTCCTCGGATTCTCGCCCGCGCTTCCAGCATGGACGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCT
GACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGACCCTCGGCGACGACACCGGATCCCTAGTGCGCGACCTTTCTCCGGTGATGG
ACTTAACTCTGGCAACGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTTCAACCACACAAGCTACGAATGCCT
GACTCCGTAAGCAAACGTAATAGATTCTTGACTGCCACCAACTGTTTCGCCGTTTTTCGTTGGTGCTCTCACCCGTTTCTCTGGGATTCTTCGATCTGTC
GTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACCCGAGATCCTTGTCTGACCAGCCTGACCT
GGATCCAGCTTGGTCTTCTTCCGAATCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACCCTTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTT
GGGTTTAGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTTCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAA
GATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCC
AAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCA
CGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATTTGCGAGATTGCTGGATCCAGCTTACCAACT
GCGCCCAGACACCGACTAACGGAGGGGGTCCCTCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCT
CTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCG
TGGATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGAGTTGCCTTGCGGGTGTGTTCCCTTGCC
TTTGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTG