Description :
From Genome Similarity Track
Location :
contig_36:178854- 181176
Transcript NameFunction/comments
g8767.t1hypothetical protein

Sequence
2322 bases(100 bases per row)
GGACAGTTTTCGAAACAACCCAGCCTATGATCTCCTGAAGGAATATAAGGACACCGTATTCCGACCGGAGCTACCTGAAGGTTTACCAGAAAAGAGAGAG
ATCGAACATCGGATCGATGTGAAAGATCCCAATCTCGCCATGTATCGTCAACAGTGGCGACAGTCGCCGGAGCAGCAACGAGAAATCGTGAAATGGGTCG
AGGAGATGGTTTCGAAGAAACTCATCCGTCCCAGCATAAGTCCACATGCCGCTCCGAAATTTTGTGTCCGAAAACCCGTTGGATGGCGTATCGTCCATGA
TTATCGATACCTGAACACCAACACTATTCGTCAAAGCATTCCCATGACTCGAAAGGAAGATATCGTGGACGTCATGGCTGGAGCTTACTACTTTTCCACT
ATGGACTTGATGTCGGCGTATTATCAAGTTCGTCTGCGGGAAGATGATATCAAGTACACAGCTTTTCAAGCTCCGAATGGACTCTGGGAATATCTCGTGT
TGCCGATGGGTGTATGCAATGCTCCTGCGACGATGCACCGCTTGGCATCCAAACTGTTTCGAGGCTTGGAAGAAACGAGATTTTTTTACGACGATATTTA
CATCTTCACCAAGTCTCGTGACGTCCAAGAGCATCTGCAAGCTCTACGGAAAACGCTGGGTATCTTGAGGGACAATAAGTTGTACGTGAAACTGGCCAAG
TGTGTCTTCTGTGCGGAGGAGATACCATGTCTGGGTGACTTTGTGGGTCGCAATGGTGTTCGCATGGATCCCACAAGGTCCAAACCATCAAGAACTGGCC
GGTGCCTCGGACACAAGAAGAGCTTCACAGCTTTCTGGGCCTAACAGGCTACGTACAACGTTTCTGTCCGGAATTGCTCGTTGACAGCAAATGTTTGCTT
TGTTGAAGAAGAAGAACAGGCGTAACTCCAAGATCCGCTTCAGCGACGACAGCTGAAGAACTTCAAGGAGTTGAAGCGACGCTTGTGTAATCCACCAGTA
CTGCGCTTGCCGGACTTCAGCAAACCAATGCACCTGCGTACCGATGCAAGTAAGTTCGCGGTTGGTGGTGTACTATTCCAAGTCATCGACGGTGTCGAGC
AACCCATTGCCTATACCAGTCGAAAGATGAAACCAGCGGAGTTAAACTACCCAACGCAGCAACAAGAACTTCTAGCGATTGTGCACGCGCTGGCAGCTTT
CCGAATTTACTGCTTGGATAAACCTCCAGTTATCGAAACTGATCACAAGAGTCTGGAAGGGATTTTCACTCAGAAGATGGCAAATCGTCGGTTGGCACGG
TGGTACGACATCCTCGCAGAATACCAACCACAATTCTCGTATCTGCCTGGAGCGCAAAACGGAATTGCTGACGCCCTGAGTCGACGTCCAGATTTGCAGC
CGGAGACGAAGTACTTTCATGACTTAAGTGTTACCAGCTTCGATGATACTTCATTCCGACTTGAGATAAGTGCGATCACAACGGACAGCGAGCTAATCCA
TTCGATTAAAACCGCGTACGCCAAAGATCGAGAAGCTCAAGCGATATTCGATGCTATCCGAAGGCGACGTGAAAGTACGAGCAAGCGTGTCGACCGTCAG
CACCGGAAGAAGTATCGGTGTTACCATGAAGATCGTGGACTGCTATGGTATCAGACAACCAGCGATGACACACCTCGTGTAGTCGTACCAAACTCGGTCA
AGGTTCGTCAACAGATCATCAGCGAATGCCATGACTCCAATTACGGAGGACACCCAGGTGCTGAGCGAACATATCTCACACTGTCACGTCACTGGTATTG
GACCAAGATGATCAAATCATCCAGAAGTTCATCGCTGACTGTGAGCCGTGTCGAAGAAATAAACCTCGGCTGACCAAGCCACCCGGACTGTTGGAACCGC
TTAGTATTCCTGAGGAGAGATGGCGATCAATCTCCATGGATTTCATAACAGACCTGCCCCGTACTGCACGGAAAGTGGATTCAATTTGGGTTGTCGTGGA
TCGCTTGACGAAGAGATGTCATTTTGTGCCAACAACCAAGACGGTAACTGCTGAAGGTGTTGCTCGTTTGTTCATGGAGAACATCTGGAAGCTTCACGGA
ATGCCTACAAGCATAATCTCTGATCGAGACCGTAAGTTTGTGTCTTATTTCTGGCAATACGTCTTCAAATCAATTGGAACGAGCCTGAAGATGACAGTCG
CTCACCGAGCACAGGGTGATGGCCAAACCGAACGGATGAACCGGACCTTGGAGGAGTATCTGCGTTGCTTCGTGGGACCACGGCAAGACGATTGGGACGT
GCATCTCGCGAATACCGAGTTT