Description :
From Genome Similarity Track
Location :
contig_36:178849- 181171
Transcript NameFunction/comments
g9179.t1hypothetical protein

Sequence
2322 bases(100 bases per row)
GGACAGTTTTCGAAACAATCCAGCCTATGATCTCGTGAAGGAATATAAGGACACCGTATTCCGACCGGAGCTACCTGAAGGTTTACCAGAAAAGAGAGAG
ATCGAACATTGAATCGATGTGAAAGATCCCAATCTCGCCATGTATCGTCAACAGTGGCGACAGTAGCCGGAGCAGCAACGAGAAATCGTGACATGGGTCG
AGGAGATGGTTTCGAAGAAACTCATCCGCCCCAGCATAAGTCCACATGCTGCTCCGACATTTTGTGTCTGAAAACCCGTTGGATGGCGTATCGTCCATGA
TTATCGATACCTGAACACCAACACTATTCGTCAAAGCATTCCCATGGCTCGAAAGGAAGATATCCTGGACGTCATGGCTGGAGCTTACTACTTTTCCACT
ATGGACTTGATGTCGGCGTATTATCAAGTTCGTCTGCGGGAAGATGATATCAAGTACACAGCTTTTCAAGTTCCGAATGGACTCTGGGAATATCTCGTGT
TGCCGATGGGTGTATGCAATGCTCCTGCGACGATGCACCGCTTGACATCCAAACTGTTTCGAGGCTTGGAAGAAACGAGATCTTTTTACGACGACATTTA
CATCTTCACCAAGTCTCGTGACGTCCAAGAGCATCTGCAAGCTCTACGGAAAACGCTGGATATCTTGAGGGACAATAAGTTGTACGTGAAACTGGCCAAG
TGTGTCTTCTGTGCGGAGGAGATACCATGTCTGGGTGACTTTGTGGGTCGCAATGGTGTTCGCATGGATCCCACAAGGTCCAAACCATCAAGAACTGGCC
GGTGCCTCGGACACAAGAAGAGCTTCACAGCTTTCTGGGCCTAACAGGCTACGTACAACGTTTCTGTCCGGAATTGCTCGTTGACAGCAAATGTTTGCTT
TGTTGAAGAAGAAGAACAGGCGTAACTCCAAGATCCGCTTCAGCGACGACAGCTGAAGAACTTCAAGGAGTTGAAGCGACGCTTGTGTAATCCACCAGTA
CTGCGCTTGCCGGACTTCAGCAAACCAATGCACCTGCGTACCGATGCAAGTAAGTTCGCGGTTGGTGGTGTACTATTCCAAGTCATCGACGGTGTCGAGC
AACCCATTGCCTATACCAGTCGAAAGATGAAACCAGCGGAGTTAAACTACCCAACGCAGCAACAAGAACTTCTAGCGATTGTGCACGCGCTGGCAGCTTT
CCGAATTTACTGCTTGGATAAACCTCCAGTTATCGAAACTGATCACAAGAGTCTGGAAGGGATTTTCACTCAGAAGATGGCAAATCGTCGGTTGGCACGG
TGGTACGACATCCTCGCAGAATACCAACCACAATTCTCGTATCTGCCTGGAGCGCAAAACGGAATTGCTGACGCCCTGAGTCGACGTCCAGATTTGCAGC
CGGAGACGAAGTACTTTCATGACTTAAGTGTTACCAGCTTCGATGATACTTCATTCCGACTTGAGATAAGTGCGATCACAACGGACAGCGAGCTAATCCA
TTCGATTAAAACCGCGTACGCCAAAGATCGAGAAGCTCAAGCGATATTCGATGCTATCCGAAGGCGACGTGAAAGTACGAGCAAGCGTGTCGACCGTCAG
CACCGGAAGAAGTATCGGTGTTACCATGAAGATCGTGGACTGCTATGGTATCAGACAACCAGCGATGACACACCTCGTGTAGTCGTACCAAACTCGGTCA
AGGTTCGTCAACAGATCATCAGCGAATGCCATGACTCCAATTACGGAGGACACCCAGGTGCTGAGCGAACATATCTCACACTGTCACGTCACTGGTATTG
GACCAAGATGATCAAATCATCCAGAAGTTCATCGCTGACTGTGAGCCGTGTCGAAGAAATAAACCTCGGCTGACCAAGCCACCCGGACTGTTGGAACCGC
TTAGTATTCCTGAGGAGAGATGGCGATCAATCTCCATGGATTTCATAACAGACCTGCCCCGTACTGCACGGAAAGTGGATTCAATTTGGGTTGTCGTGGA
TCGCTTGACGAAGAGATGTCATTTTGTGCCAACAACCAAGACGGTAACTGCTGAAGGTGTTGCTCGTTTGTTCATGGAGAACATCTGGAAGCTTCACGGA
ATGCCTACAAGCATAATCTCTGATCGAGACCGTAAGTTTGTGTCTTATTTCTGGCAATACGTCTTCAAATCAATTGGAACGAGCCTGAAGATGACAGTCG
CTCACCGAGCACAGGGTGATGGCCAAACCGAACGGATGAACCGGACCTTGGAGGAGTATCTGCGTTGCTTCGTGGGACCACGGCAAGACGATTGGGACGT
GCATCTCGCGAATACCGAGTTT