Description :
From Genome Similarity Track
Location :
scaffold_213:17883- 20056
Transcript NameFunction/comments
g5755.t1hypothetical protein

Sequence
2173 bases(100 bases per row)
AGTTGCGACTCGCAACCATGTCCCTCCTACAACCAACGCTAGCATTACAATGAAAATTTGTTACAGTACATGTATGGATCCTGTGCTTTTGTACAGCTAC
CAAAACACTACAGCACAACTGGTGAGGCTATTCAATCAATGATCGTGGTCATGGATGTTCCTAATCATGTTTGGTCACGCCCTGTGGTCGGTCAGCTCTG
ATTAGCGCCTTCATCCTGTTCCTAAATCCATATCAAAAGGCCCTCCCTCGGCTTGTAGGCTTCAAAAGTATAGTGGATATAGCGACATGCATGTAACTAA
AGATCAGTTGATTTCACCAATCCATCCTAGACTTCTGGTTGCTCTTTATTTTTTACAACGAATATATTTTCACTTGTTTTAGTCAAAAAAAGACAAGCTT
TCTGTGCTCCTCGTATCGGACTGCGAGGACGTTGAGAAAGCTTTGTACGCGCGATACCCCGTTGCCTGATCTCTTGCTGCCTCTTTCGCGTCCCATTTGG
TCGTTTCATTCACGCATTTCGTGCAGAAAGATATCTTTCGTCGGAGAAGCTGATCGTCCAGAGCGATGAAGCTAATTCGTTTGCGGACTTTGCACGAGTA
ACACACGCTTCCGTAGCAAAGTTTGCACGTGCTGGCTCCGATCAACCCCCTGATGCCTTTTGTCACCTTCCTGTCACATACAACGCACTTTTCTCCGTTT
TGTTTACCTTGCCGCTCGAAGGACGAATGTCGGTGCTGCAACATCCACGATAGCTTCTTCATCTGGCCACAATACACGTAATTTGTCGCTGAAAGCAGCG
CTTCAGCGGAAACTTGGATGCATATGAAGCGCGCGATCTTCCCACCCGGAACGACTGTGCCACTCGCGTAGATATCAATGGTATTGGGCTCAATCTGGCG
GAAAAACCCAAAGACTGACAGGTTTCCTCGGATCATATTCGGCAATGGCTTGGTCTGCGGGAAGTCAATCGAATGAAGCAAGTGGTAACCCACCTGCTCA
CCGTTGGAAAAGTGCATGATCCCCGTCGCCTCGATGTACACGAAATCTCGGCTTTTGACCAAACTCGTGGACTGTAGGGGTAAATCGATGGTCATCCACT
TGATAACCAAAGACCGGAAAGGTTCCTCTACACTTGGCTCAACTACTGAGCACAGTACAGCCGCACTGTCGAGATCGTGTACGTACGAGGCCTTGATCCG
CATGACATCTAAAGTTGGATTCACCACGCCAAACATAACGTCGTCAACGTCCCCCACTAGCGTTCCAACACTCAGAACCACAGGTAAATCCTTCTGAGCA
GCACCAGCAGTTGGATCCCAAGAGACCGTTTGCTCTGTGGCTTTCTGCTCCTTGTGAGGACGCTCGGAGTACACGTGCTGGTTGTCCTTGGACTTGACAT
GTTTCCACCGTTGTTCGCCCACCTGGCTCTTGCTCACGATCACAAAGTCCTCGTATTCCTGGAAATGATCTTTCACGAAACCGTTGACGAGGTTGATCAA
TTGGTTGCGTTCATCTTCGGACACTTGCAGATCCGGATACGGCTTGACACTGAACCGGTCCTTGGACATGGTCAAGTGATGGAAAAGGAATGCGAATGAC
GCAGGATTTCGACAAGTGCGCTGGAAGTGGGTCTTATCGTACCTGGGTCAGTCGCCATCGACAGTCACCATCCTCTGATTCTTACTGTGGGGTCTTACGT
GCGTGGCCTGGGGACGAATACGATGTTGACAGTCGACTAGACCACAGAAAATGATAGAGCAACACGTGGGAAACCGCAAAGACTCTTGGGAAGTGCATGC
GGGATTGTGAGAGTTTCAAAATCGTTGTTGAAGTCAATTTTAGTGTGCGCTGCAACTTGTAAGGAGGAATCGAAGTTATGGAACTGTTGTGCCACCCACC
AGAAGGCACTTTGTGGGCTTTCCACTAAGCTCGAAGCATGAGCATTCGCCTCGTTCAGAGTTGTTGAAACACGTGCGCAACTTTCACAAAAATGGCAAAC
TGCTGACAATATTCTCCGACAATCTTGCAAAACTGAACCGCAATCTATTGAAAATTGAAAGTAGTCAACGTTGCGCGAATGTTTTCCCAGTAACAACAAT
TATTGGAGAATTGTTTTTAGACAACAATATTTTCTGAGAATAATAAATACAAGTACTCGTGGAGTATGATTTT