Description :
From Genome Similarity Track
Location :
Scaffold_24:17879- 19916
Transcript NameFunction/comments
Phyci_79291Hypothetical protein

Sequence
2037 bases(100 bases per row)
CGCCATCTCCACGTCTCCGTCTGCGTCCTGCCCTGCTAAGCCCTGTGCCGATCTCTGATTGGTCGATTCCCTTTGCTGCTGCAGCTCGTCCTGCATCTCG
TAGTGGTCCATCATGATGGCGCAGAAACCCTCGACAGACGCCTCGGGCAGCGACAGGTAGCCGCGGTGCATCTCGAACAGCCCGCGCACCATGGCGCCCG
AGCGCTGCGGCAGCCGCTCCTCCAGCTTCTCCCACTGCCGCCCGTGCGCCTTGAGCAGGATGTAGAACGTGCGCAGCTCCTTGAGCGTCCAGCGAGGCCC
CAGCACGCGCTCCGACTGCAGCATGGGTCCGAGCTTATAGCAATGCTGCGGTGGAATTGATAGTGAAGCGATTTCAGCCAATTACAAGGCGGTTGATAGT
TGAGAGTGTACAGATTGCGCGATAAGGGATTGTATGTTGTAGTCGACTCAACAGACTTGAATACTTACCCGAGACTTCTTCAGGCACGAAGCTTCTAACG
TTTACAGAGGTAAATGCCATTTAGGGTCGCCAATCTAGGCCTTGAAGTTTTGTTTGTATCTTTCGCGCCAGTAAAACAAAAAAAAACACTGTACGGATAC
CAATCAAAAGCTGCCACGTGATTTGAGATAGTTTCATCGTTTTCAGTCCTTGGGGACAGCCACTGCGATCACGCAACCCGCGTGAAGGTCCTGCCAAATA
GAGGATACTTCATATACATCACTACTTGCATCAACGTTAGAGACGACGACCAAATAATTAGCCCATATTAATGGCAGGCCCCTTTCTCTGGAAGTTACAG
TACCCAAGTTGGCTGGTACCACGCTTGACGCACGCTCTCCGGCTGCACTTGAAGCAGCTTTCCCACCCAGCACCTGCGACTAGAAGTCATGGTCCACGCG
CTGATCGCaaacgcgcggaagaaatccgccgtgaatactggttcgcgatcgtgcctaatcacctcactagtaccgagtctccggaaaacacattcttcat
aggattcagcgatcgtctgggccgtccgggaagagctggctttcgcgatcacgtatctcgtggacagatcgacccaaatcagcagctccgtattgccctt
gtacgatttaggtagcgagggtatgtgatccatagctataatcaggaatgggttggtcgcctggatattcccgggcgattcgcctctgatcgtgggcctt
ccttcgccagtctcgcagtccacacattcgcccacatacctttgtacactcctgaaaagacctctccagtggaaattattgcggatccgctggtaattgc
gttcgattccctggtgtccaccttctaacgtcgcgtgatagtgatgtagcacatcttgatgcaacgtttccggcaccaccagcctcattaacccgtcatg
atccgtctctgatcgccttgaaggtgcgcaatagaaaagcaggtcgttaccgtccaactcgtagtcggccgctatgctaccataggatcgagcttcatct
tgcgtcagatttggcactttgcccatcagttactgcttcatgccggcgatccacacttcttcttcctgcgcctggcggatccgatcgattcctaactctc
ggacgacgtcctcctgcatcgcggcgggcctcgatcgtgacctagccccggattgggtggttactggcgagatccgcgccactgtatcgtcggacctgac
tactaagatctcgtccagtcgatttagcgtacacagatcctggcgatcggcctcctcctcgatcacgacgcccccttgacgttggagcgcggcgctggct
aaactgttggcactcccattccaatctcgcttcacgtgtaacagctcatgatctggccaagtccgtagtcgatcgggcgccttctgtctcagcagcgtca
gcttgggcgctttgtagtcgatctcgccgcggacttgtcgaactaccaagttggaatcaccacatatgactaatctgcgcacttccatgtcttataagag
atcgaaccccaacaataggtcgtgatattcctcgttg