Description :
From Genome Similarity Track
Location :
scaffold_5:178771- 182066
Transcript NameFunction/comments
g8131.t1hypothetical protein

Sequence
3295 bases(100 bases per row)
TTCACCAGAGGTAGACGGCGTATTCAATGATGTGGTCGACCAGCGGCGGCGACAGGTATCGCCACCGAACAAGCTGTTCATCTGTAACGAATGAGCCCAT
GAAGGCTGCAAACATCCACCCCAATTGCAGCATCGCCTTCTCCTTCCAGCTAGCAATCGACGACGAGGATGCCAGTCCAGCGCTGCCAGGCGCTTGTCGC
TCTCGTCGCCGCAGCGCCAACGTGTTCGCGTACACCACGAGGCGGCACTTTTCGCGCTCTGCCGGTGGGAAGTGCCGATGCAATGCCGGACTCCACACCA
CAGCCCAGTCGGGGGACAGCATCAGCCTCACATCAGCGCGAATCCAAGATGCCATCTCCTGCCAAAGTGCGTTCGCTGCCATCACCAGTTCAAAAGAAAA
ACTCAGCACCTCATCCCAGCGCGCTATTTGCAACAATTGTCCTTACGTAGCGTTGCGCGTGAAGCCCCGTTACTCAGCAGAAGCGCAACCAACGTGTTGT
TCTTGCGGGCCATCGCAAGCGTCAATGCCGACGACCCCGTCCTAAGCTCACAGATACCACAACACACCATCATATTATTTTCAGTCTCGCGATTGTGATA
GTGTCAGGATGGCTGAGGAATTACGTGGAGGTGGCGTTCAGGTCAATGCTTTCCTCCTGTAGGAGCCGCCGCACGACTCCAATGCGACTGTGCGCCACGG
CGTAGAGCAACGCCGTCCAGCCTTCGCCCATCGTCACGTTAACGTCACCTCTTGCTCCAGTCGAGAGCCACGCGTCGACTACGATGAGATCTCCATCCGT
CGCTGCGTCCAGGAACGCGCGCTGCTTGAGGCGGCAGTCGAGCGCGCCGTCCGCCATTTACACCGCTGTGTCACTAAGCCGAGGTGCCACTAAAATCGCT
AAAAAGCAGTCGGACCAATCACTAAAATCATTAAAATGCCGTCGGACCAACTGTAAATAGATGGCTACAGTTGAGAAGGGCGCTATTCTGTTGCTTTTAC
TAGTGAAGATTGGACCGCGTTCCATGTGTACTACGACCTTGGAAAGCAGATCTCGGCACCTTCCTCTTCTTCGCGGAGCTCATCCCTGTCTCCTTCTTCG
CTCGAGCCGATTGTAAATTTCGGGGACGGTCCTTTCCTTGCGGCTCGGGATCGTGGAGAGAGCGGACTTCCTGGTGGAGACGCCGGCGACGGACTGTCGT
TGTCGATAATGTCCACAATTGTCTGCATATATGCACGCGAGGTTTCTGCCGCGTCAGGGATTCGAGACCAGGCGCGCGTGCGCCACTTCGTCCACACCAT
GACGGCAAGCGCGACGCCCACTAGCGAGATCAGAATGACTTCTGCGACAAAGGCACCAAAAGCGGGGCTTGACCTCTTCGTCGCCACTCCAGTGGTTGAG
CTAGCCGCGACTTCGGGACTGCCTACTGTGTTGGCCAAAGCTGTTGCTGTTGCGTTTGATTCAGCAAACGAATTGTTGCTGGAGCTGGCGGCGGAAGAAT
TCACTAAGAGTTGCGGTTCAGTCGTATCTGCGGTGATTGGTGCGGCACTTTCGGATGTTTGCTGTTCAGTATTATCTGATGCGATCGGTGTTGCGCTGCT
ATTGTTACTATAACCTTTTCCTGTGAACCGTCAAAATATCACATGGACTTAGGACTACGTAGTACGTTTCGGCATCGAGCAACAAACCCAGTGACGTACC
ACAATCAGACTCAGCAAAGCCAACACGCTTGTTCTCCGCATCAAAGATCACGTCGAAACCAACCATGGTACTCGCGCCGAGAACTGGTTTGGCGAAAACA
AATTGTTAGTTTTGTTGCAATTGCACACACAAGAAAAGGAGACATAATCTTACCGCCACCACTGCGTTCCGAAAAGTGAAAATTGCCATAGTACGATCCG
TCGTCGTCGGATGGTGTGAGATACTGTGAGGCTGGAACATCCAGCTGAATGTCATCGGTACCATCCCCCTTCATTCCAGACAGTATAATGGAAATTGTTG
GAAGGGATGCTAACTCATCGGTGGTAAGCTTCATACTTTTCTCGTTGTACGCGCGACCCCCGGCTGCATTTTTGAACGCATTCAGGAAACTGCGCTGTCC
TTTTGCGTCGAAAAAAGTGTCGGTTGTACCGCTGTCCACAATTATGCCTCTGCCTGAATTGATCGTCCCGGCGTCAATACCAAGCGACACTCCATTTAGC
CGGATGTCCTTCACGTGGACGGGATAATACGCTGACTTGTCATCCAGCAGCGGAGTGTAGCCGACATTGCTTGTGTGATGGCTGTAATCCACTCCTCCAA
AAACAAGTTCGCCACCATCTCCCGCAAAGCACAATGTAAAGAGGTTCTGCGTGATACGTCCAGCGCTCAGCATGTAGGACATGACAGTCGAGCGATGGCG
ACCAAGACCCATGATGCCGTTCTCCTTCTGAGTGATGAAGAGACCAGTCTCTTTAGTCTGGCAGCCCACTGGGAATCGAAACCCGAACGTCTTCAGTACT
CCCTCCACCTCGTCATCTTTTGAGGAGAATCCTCCGACCCACACCAACTCGTCCACCATGACGGCCTGCCACATGCTACCCTCCATATAACTCTGTTCAA
ATGACAAACACAACATAAGAAGCAGTCCAGAAACCAATTCAAGAAGAAGGCGCATCAATACCTGGGAGATATAGCAGCGGTTTTGCTCACACGACCGACA
AGAATCAAAATCATGGCATCCCAGATACTTGGCCGTCGTCGACTTGGACACATCAAAAAGAGGGTCCGTGTGCGTCCCGCAGCCGTCACAAGTGCTGCAC
GGCAACGCCGTCAAGTGGCTACCCGTGTCCACAATCACAGACGCTCGTTGCGCTGGAATCCCCAAGTAAATTTCAGCATAGTGAGTACTACAGTGCACAA
AAGCAAAAATCAGTTGAGAAGCCACTACTCTCGCAACCTGTTCGTACTCACCCTAAGCCTACACCCAATGGAGCTTCACTCAGAGCTAATGTCCCCAGTG
TAAAGTCTCCGTCCGCGTTCCCAGTCTCCTCCTGTGCTCGCCTCCGCGCTCGCTCCTGCTGCGTCGCCAATCGATAGGCCAGGTCTGCACTCGGCTGCTG
CTGCTTGTGCAGCTGAATTTTCAGGAAACTCTGTTTGCCGGCGGCAAGAGATGTCATTTGAGTGTACGCTACTGCTGCAAAGACTGCCAGAGACGCTCGC
CACCGAGCGCCAGCAGCTCCGCTTCGAGACGTCATCGTCAATAACCCGAGTGAGGGCTTCGGCAGTTATAGCGGATCTATTTATAGCCAATGAAA