Description :
From Genome Similarity Track
Location :
Scaffold_40:178758- 180149
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14069hypothetical protein
Phypa_INRA-310PPTG_14070ATP-binding Cassette (ABC) superfamily

Sequence
1391 bases(100 bases per row)
TTCGTAGATGGCTCCTCTGATAAAGTCAAGTACTCGGGGTGTTCACGAATGAGCTCCATCTCGTCCATCACAGTGATACCACCCGGATGCTCGTCGTCCG
CCATCCAATCGTAGAAATCTACCAGCTCCTCATGAACGTCTTCAATAACACCACCAGCAATGATTTTCACTAGATCTTCTTCCACTCGAGCGACATCAGG
TTTCTACATGTAGCAACAACCAGAACCGCTTCATAAGTCGCAATAGTTCAAACAACATATCCTTTCGCACGTACTGGGAACGGCGTGGTCTTCTTGGTTT
TCTCGTATTTACGCTTGATGACGTTGGTGTTTGGAGGAGTTATCCCGTTTGGCACTTCGTCCTGCATCTCTAGTAACTTTTTCTCTTCTTCTTTGTCCGT
CACCACGAAGATCTAAAATCGCCAGACAATATCACAAACATTCGTTAGTTCAATACGCCACCAGAATCATCTTATCCTCTCTGGTCGATCCGCACCTGTC
CGATTTCACCGCTCTTGTAGAAGAAGTTGTCGTCGTAGGTCTTGTGCGTCTCCAAAATGGTCGGCAGCTGTGCTGCAAGCCCGTCAACGTCAACACGTGC
AGCTAACGTCACCTTTTGACCACTAACAACGCACCAATCTTTGCAGGATACTTCTTGCCGTTCACATGCAGTGTAAAGTGTTTGTTATCCGCTGGAAAAG
GCATCAAACAGCACCGCAAAATGCGTCAACGTATGTATTTTCCAACTTTTCTTTTTTCGCTTATTTCATCCCTCTAGCGGGTGTAAGGACGGCAAATAAC
GTCACACACGCACCTCCTGCCACCATGTCCACGTTCGCTGAGTCGCCATTCGCGATACCTTCCCGTACCTCCTGCGCCAGGCGCTTCGGGAGCTGCAGCA
GGTATTGCTCCATTTTGCTCCGGAAAGGGTTACACAGCGATGGGTTACGAAATGTACCCTGCACTCTTTTGTGTCCAACACATAATTTACACCAACCGTC
GTAATCAAAACCATCACTCTGCATTGTGTTTCCACACCAACTGAAAAACGACCCTTTACCCTTCGCACTTCCGCATTCGCCTTCAAGTCCGCACTCCGAG
GTGATGGCTGGCAAGCTGCAGGTGATGAAGGCGCAGGCGCTGGCGGAGGAAGAGAAGCGCCCTCTTCTCAAGGACATACACGTGTCGGTGAACCGCCATG
ACCCTTCTTCTAGTCCGCTCTCAGGTCTGGGCGACCGGTACCCGTCTCAGGATGCAACCTGCATCTCCTCGGCTCTCTTCTCGTGGGTGACGCCGCTCAT
GGAACTGGGCAACCAGCGACCACTGGAGCACGACGACCTGTATCTTCTAGACCCGGCTAACCGTGCGCATGAGGTGTCCACGGAGTTCCAA