Description :
From Genome Similarity Track
Location :
Scaffold_752:1787- 5594
Sequence
3807 bases(100 bases per row)
GAAGTGTGCAGCAATATGTGGGAGAATGTTTAGACTGTGAAGCGGGAAACGGACGACCCCAGGATCGGAGTGGGTCGCTAGGAAATTTACAAGCAACGTA
TCCTTTATCGATTCTAGCTATGGTTCATATTTCGTCGCTGCACGATCCTTTGAGCGGAACACCACTAGTTACTGTGGGTCAGCTTATTTTCTAATTACGC
AATCTCGAAGGCTAGCTCGTCCAGAACCGCACAACGGTCGCGGAGAACTACGAAGAGTGCGTATTTAGCTGGTTCGGTGTTAGTGAAGCAATATGCCACG
ATCGGGAGCCAGAATTTATGTCCAATTTCTTCCGAGATTTTAATCGGATCGCAGATCACAAACAGGGAGCTACTATGGCGTATAGGCCGCATGCCAAAGG
TTCAGCGGAACGCATGGTGCAAACGTTGACCTGGGTGATCAAGATGTATGGGGTGGATTAAAACCAAAAAGGTTGGGACGAATATGCAGATCGATTGACT
AATACGATTAATACTGCGCAGGACAGAGTCTGTGGGGATATGCCATTTTATTTGATCCATGGTTTGAATCCAACATCAACCTTGGAGCAACCTTACATTG
GGAAGCACCAACCCTCGTGATCGAGACCCACGATGTTGGCGATGCAACATCCAACATCAATTTCAGCGTGTATGGGCGGTAGTGAACGATCGACTCGAGA
GCGCGATCCAAGATCGAGCGCATCGACAAAATGAGGATCTCGACTCATTGGATGTAGGTTTTGGATTGCAGGTTTGGTTGTATCTGGGTCGCGTTAAGAA
AAGGTACGCTCGAAAGTTAGCTCATATGTGGCATGGACCGTATCGGGTAGCCGAAAAATGTGGAGATCACACGGTATGCTTAGAGATCGCAAACACACCT
TACAGATTATTCCCCGTATTTTACGTTTCAAAGCTGAAACTGGTAAGGGTCTTCCCAGAACGTCCTACCACCCAAACAAATTTTTAAGAGAAGGATCGAT
TCGAGTATGATAAAGCTTTGCTACCGGAGAATAGTTGGAAATGCGATCGAGACAACAATGGAATGAGGTGGATAAGATTGTTGATGTGCGATCGGGGCGG
AAGACCCGATATGGGAGATTTCACAGGCAGTATCTGATACAATGGAAAATGTATGGTGACTTCTCCAGGATTGCCGGAGCTGATCTGAACTTTAAGACCT
AGTTCCAGAAGCTCGATCGAGATTTTCTGAGTAGGAGCCGTTTCGAAGTAATGCAATCTCATGAGGAAGAGTCCGAATATTAACGGAGTCGAAAANNNNG
ATACTTGAGATGGTAGAAGGGTGTGTGTGATATGTTAGATGGGGGAAGGGTATGTTATGTGCAAGGAGGTTTCATTAGATGGTGGAAGGGTGTATATATG
TATGCATGTGGAGGTTAGCGAGCGCATATATCGGATAGCGGCAAAGCACGCCAAAAGAAAGAAGTTATTTTTAACGGAATGGAGATGACAAGAAATCAGG
ACGGTCATCTCCATTCCGTTAAAAATAACTTCTTTCTAATCCGATCTAAATAATACGCAGGGAAGAACTTACCGGATAGGCGTGAGACCGACGATACAGG
ATGACTTGCAGGAGAAAATCGATACTGGTTGCGCCAAGGCTCGTCGGCGTTAACATCGACAGCGCTGTAGCCAGATTTGTTACATTCTTACGCTTAAACC
CAAAGCCAGAAAACCAAGACAGCACCACGTATAATCCAGTGAAATGAAGGAAGAAAGGATCCAAAAGGGTGTTTAAGTCGAAGTGGCCGTCTATCAGTTT
TTGAAGGATGAATCGAAGGATCTTTTTCCAACAAAGTCCAGATCGCCTACGTCTCTGCTTATGTTGACGACAGAATTGGGCCGGATCGGGATCGAGCTCA
AGCTGTTCTTTGGACAAGTAGACGGAGTGCGTCGACGCTCACACAGACTGCGGGGACCGCTCTTCTCAGTCCATGTACATAACAGCGAGTAGACTGAAAA
CCCAATACGGGGAAGAGATATCGGGGCGATCTTCCGAAAAGCACTCTTTCAAGGTTCTTGCGCATAAATTGCCGCGATCTGATATGAGGTTGTCAACCGA
GGGGTCACCGGAGGCGGAGCGATCTTCGGGGCTTCGAGAAATGTCGTGCGAAGCAATCAAGGTCGAGCTCCGCCACGCTTGTCAAGCCAACGCATCGCGA
AGACCATGGGGCGACTTGATCGAAAGATTGGGATACCCGATACAGATATCCAGGGATCCAGATATCCCGAGCAACCTTGACGCCAGGCAGTTGGACGTAA
TCGGCCCGCGATAACAACGGATTCATCGACGCTCGCTCCTCCTCCGGAACGCTCATCGTGCCATCGGAATCGCTAGATGCTCCCTCGAATAGTTCTACCC
TCGGCGCTTTGGCAACGCCTAGTCGGCTAACGGGGAAGTAGTCTTCTTGAGGGATGGGAGTATCCAACACGATACTGGTTGTGGGAGATCCGGGTGAGGG
CGGTGAAGATGTCGAAGGTTTGCGACGACGGCGGGCAGACGATCTCGATACTGACAGGGCAGCCAGAGCCGTGTCTTCAAAATTGGATGATCCTTTATCT
TCGCGAAAAAGTTTCACGACGGTTTATTTTTCTGTTTCTCTTGACCAGGAGGAGGCGTGGGTAGATGGGATTGTATACCGAGGGTTCCGACCTTTAGCAG
CTGCGAATCGAGTCTCCCGCTTCAGTTCAGGCGGAGGGGGAGTGGTCCAAACTCTAGTAGGTCCGGGTCGAGCCGCCCTATTCGNNNCAGACAGACGGAG
TGACGACGAAGGATCATATGATTGTTTGCGACGGGCCATTGAAAGATATGAAGTAGCTTTGCCCGCAGGAGTGGGTTTGTTAGAAGCCGATCCCGACCCT
CTCGCTGAAGAGAGTTTATCAGAAGCCCCCGATCTTCATTTTGCATGCAGATTTTGAGGCTTCCCAGTTACCAACTGCACCACGCGATCTCGCAAGCAAG
TGTAATCTTGAATTTCCTGATTGTGCTTTGAAGCCAATTTCGCCAGATCGGCAAATAGCTGATCTATAGTGGCGTCGCGATCATTCACAATGTGGTGTAA
CCAATCGCACTCGACGTGCTGAGAAGACAGGATGTTTCCACTTTGACCATATTCCACTTCAATTGCTTCAAGGCGCTCAAGAGTTCGACAGTGTTTGTTA
TGAGCACCGAGAAAAGACTTTCTGTGGCGCGAATTCTTGTCCTATGCCATGTACAGGAGATGTACAAGCCGAGTACCCGTTTCCTTCATCTACTGCCGAA
TCCTGGCGATCAAAAAGCGGTTAAAATTCTCTCCCTCCGGGTGGCGCGCTAGCGTGGCCAGGAGAAGCACCGACTTATAGCGTGCAATATCTGAAGACTG
GTCAAGGGAGTAGCCAACTCTTCCCAACATGATTCAGATAACTCGACCGCTTCCTCCTACTGAACACGCAGTTGGTCGTACTTATTTGTACAAACTTATA
AGTAAAGAGGCGGAGGTGCGTAGATCGTGAAGTTTGTGCTCCAACGGATCCGGGAGATCTGTTGGCCCAACGTGTGTTCCATGCTACGATAGCTGCCGAC
GACCTCTTGATACAGTATCATCTGCTGGTACGACGAAGCAATCGCACTGTCAACCGCCTCACGATCTACAAATAAAGGGATCCCCACGCGACTGCTCGAG
ATCAAGATCAGATCACCCAGACTGGGGACGGATTTGTTGCCGTCGGTTGTCATGGCACTCGAGATCGGGATCGCGGACGAAGAGGAGCGAGGGGTCGAAG
GATCACC