Description :
From Genome Similarity Track
Location :
Scaffold_802:17867- 19905
Sequence
2038 bases(100 bases per row)
CGTTTTGGTAGGAGGGAGAAAATAAATAAGCGGGGCTGGTTTTTCGCGTTTTGGACATTTCACTTCATTttttcagcagcagaatAACTTGGCATATAAA
AATCGAGTGTTTTCTATTTGGACAGCACTCTTAGCTATGCCATCTTCTCAAGTGACGATTTAATGAAACTCATCAGACATAATAGGAAAATTAGGTTATG
CAGGCCTCGAACTAGAGAAGGAGAACTTCATAACTAGCCGCGTGCATCATGCGTCTTCATGCCGTGCGTATTGGAAAAATTTCTGTGcgtattttaataa
aatGTTTTAAAAAAATCTTATGTGGTCAACATTATAATACGAGATGAAACGTAGAACGTAGAGGACTTTCAATGCTTTACTTCAACGACACCACGAAAAA
CTACATGACATGCATTTAATACATTGTTCATCGTCAGTCGAACATCAGCACCATTACTATCACGGTATATTATTATATTACTTCCCACAGTTATAGCGTG
CGTGTAAAGAAATGTAAATACTACTTTGAAGTCTACTACTTAAAGTATAAAACTTTTTaaatgtattaatacatcCCAATGCCAACGTCTGCTTTTTGGT
CAGAGATGAACTAGCGTTTCCCATAAAATGATGTCCAGTGGTAGGTGGAGGTTTCGTTAGTGTCGTGGACGTCGAACTCGTTGAAGACGGATCGATAGAT
CTGTGTGTCCTACAAGCTGTCCCTGTAGCACACTGAAGATATACTTTGGCAGTGTTCAGACATCGATCAATAGTCACCTCAATACATGGTGCAAGGGCAC
ACTGTGAACCACCCCCTTTATCACTTCGCAGTATCTAGCACCTTCTAAACTTAGGTCATCACGGCCTTCATCAATCGTTGTGAACCGACGAACTCAAAAC
AGGTGCGATCGAGTTGGGTGCCTTGGAGCTAAGTTCTTACATACCAGCAACATGGAATGGAGAGGGTTCAATCATTTTTGTTGGGTGCAAGTTAATTTGA
GTTATTATTCGTGAAGGGTGCCCGTTTGCAGTTTCTGGAACTGAACTAGTGACACCGAAAATTCCTTGGTAGGCAGCTTGACATTTGGCATTTTTTTTAT
AGATAAAGTGGGTATTATTATATTGGGGGGGCAGAATTAGCTTTTTAGTGGTGATTTTTCTGTCGAAATGGTCACCATTTTTTTTATGGTCGACGGACAT
TTTATTGTTAGAAATGGTTCAGCTATTGAGGTGAACCATTTGCGAAATGACCAGCCGTTTCTGAAATGGTTAACCAACCGCCACGGCAAGTTTCCCTTCG
GTCTTGAATTTTCTCTCGCAGCCCACACTTCTAAGAGCAAGGTTTCTGGGTAGAAGTTAGTTTGTCCaaaatctgtccaaattgtccaaaagtAAATGAC
CGAATTATCAGAAAGAAATGTTATTTTAGTAGAAGAACTAGTAAGTCCCTGGGTTGTCCAATCtgtccaaatctgtccaGATCTGTCCAAACTGTCCAAA
CTGTTCAAAACCGTCCCGGTATAGCGTCAGAGTATTTTAGCGTTGAATACGAATTAGTATGCGGCCTACTATTGTTGTAGAGTACCCTCCGGAGCCGGGT
AAGGGCATTTTGCTTGGTAAAAGATAATACATCCTAAAAACTGTCTGTAAATTTCATGAGAATGGAGCAGATTTCGTTGGTCGATTAGGAGAGTGCACCG
GTTTTAGGACAAAACGGGCGAAATTTAGCTATCCTAATAGGAcactcttcatccagactCATCCAGACACTGGATGCTGTCCTACTAGGACACTGTAACA
CCAAGTATAACTTGCTGTCAATTATATGGTGAGTGTATTACGAAAGCGGCTAAGCATTAGGCGCTAACGGAGGCAAGCGGTTGCAATCACGCGTAGCCAa
agcaaacccgcgcggtatttgcggaggcgggcccagcgccgaggATTCCAGTGAGCGGAGGCTTACACTTGCCAGGACATTCTATCTTTATATCCCGAGC
GAAGCGTAGCGCGGTCGGTCATAAGTTGATAGTCCAAC