Description :
From Genome Similarity Track
Location :
contig_78:17866- 19700
Sequence
1834 bases(100 bases per row)
CACTTAGCCCCGGATCAACGGTTTGGAGATAACTTGCCCAAGCATGTGCTATTAGCCCAGATACATATAGGAGCGGAGGCTACAGCCTCCCAAAACCAGG
AAATCAAAGATCTAAAGACGGACCTGTCTAGGATTTCGCTCGATATAGATATACCAGTGCTAACAGTGCTCTTCAAAGGAAAGAGAACAGCAATGGTTGG
TAATTGTCACTTGCGATGAAGATGCTGCCGCTTATTGATGTAACGGGGTTATATGAAGAGTACCCGTCACTCTTCCGAGTTGGGTACATGGTGTATCCAA
CACCACTAACGCGTGGATGGTGACACGGTTTTTAGGTAACTATAACTATATCACTATAATATCTACGTTCTTCAAGTCAACCGTTCCCTTAGACCGGGAA
CCAGCGGACTGCCGTTCACTTGCAGTTTGTATACTCCTAGCACTTCCTCAAGCGCAAGGTGCTGTGTGATCCCGTCACAATGTAAGCCATGTGAAGTACC
CTGACGAAGCAAATGTAGCGCAACAAAATGCAGCGAAGAGAAGCGAAGTTAAAGGGATACTCCGGTTTCCTGGAAGGCAGAGTACAGCCAAGTTCAGCTG
GCTACATGTAACGATACTGCAAGCCAGACCAGACAAGAATAACTGGACGTAGTTAGCATCTGCAAAGCCGATGACTCATCAAAGAAACCTAGTTAGCGAG
AATTCATTTAGGAAGTGCAGCTACAGCAAACAGAACAAGTCAAGCAGCGTCGAGGGTTCAGCGACCAGTTCGTAGCTCGTAACTATCCCGCAAAGACGAC
AGCCCACATCCTTCCTTTCCGCTATCATGTGGTAGTTTGTCACTTTTCTAAACTCATACAAAGTGATAATTCCGCTGTTGGTGGCTTCCCTTAAATATTA
ATAATAATGTTGCGGTGTATTGTGTCACTTACTCCTTCGAATTGGACTGTAATAACCATCCTCAACAGGTGCTTGCTTACTGTCGAGTTGTGCAGCCTCT
CCTGCTGCATGTTTCGTTCTCATCCTTTGTTGTGTACTTATAGTGCCCCTTCCTCCTCGATCCATCGTACACAGTTTCCTCTGATACGAGCTTCGACTCC
TTTGCGTACAGGATGCTCATCCTCTACATCTTCCATCGTTATCATACAGCTGGCCTTGGAATCATTCGCCAAGTTTCCTAGCCAATCTGCTGTTGTGTTG
TGCTCTCTGTACTGATGTGTCCAGCTCGCTACTTGGCAATCATATGCCAGGCTTCTGGATATCCTGTACCAGTCCTGTATCTTCTTGCTTTTAGGTAGCT
TTCGCTCCTTCAGCATCCTGATATTCATTGCGCTATCGCCCACCCTATGCAATCCGTACCACCGACATTCCGTTGTCCATTGCAGCAGTCTGTGTAACCC
CTCGAATTCTGCGACGTTGTTAGTTACCGTGTTGATGCTAAGAGCCGTGGGAGCTGCCCGCAGTGACCGCACTTCTTTGGCCCTCTCATTGCCATTATAA
CACCGCCACTTCCTCCAGAGCCCGTGTTTCCTCTTGATCAGCCGTCGAAGAGCCCCAATCGTTCACAAATTGCCATCCCTTTTGTTTCGTCAGTCCGCGC
CGTAGCCACTCTTTTTCTGCTAGCTATGAAGGCCACCGTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAAGCATACA
TTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAAGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGG
GGGTTCTGCCAGCCATCCAATGGCAGAACCTCTC