Description :
From Genome Similarity Track
Location :
Scaffold_72:178641- 182024
Sequence
3383 bases(100 bases per row)
GACTCCCATCCACTTGTTACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGAATTGCTTTTTCATTGTT
GATCTTGCCCCCTACCTTGGCTTGTCGGAACCATTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTCAGCAGATCCATGGATCCACCA
TCTTCAGATCCCCGGGATCCAGTAACCTGACAAACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCT
CCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAAACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAAC
TGACACTTCATGTAGATCACATGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACCTA
GAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCAGGAACAAA
CCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGGATCTCGCGACAACGACGACACACGTAGAAGCAATGATCTCCGGGA
TGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAACATCCAGCTTCTATGTGTGCTTCCGGGATCCGCACTGCGAGCACCTGATTTGTCCTGG
CCCGTTTATGAGATCTCGGGGTCTGTACATCCCACGGTCTCCGGGTGCGGTATCGCCAGTACGAGAGTGGTCTCCGGTCTTCGCCGTACGATCGTTGGGT
GCAGTGAGACAGACTCGGCGGTAATCCTCTGGGTCGGATTCCGAACCGTCGGATCCTGATTCGGTTCCTGAGTCGTGCGCCGTGACTTGGTGGACACGTC
GAGCTGGAGCCGTGGGCGTCGGAGTGTTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCAACAGCCCGCAGCA
CTTCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACATGCTCCCGTAGTACCTTGGA
CCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGATATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAG
TATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCACCAGGAACAAGTGGCAAATCAGGCCACTTGTTCCTGGTGGATCTG
CCTAGCTGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGACAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACT
TGACTTTGCTGATCCATGTTTTCACTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGGTCCGTACCCTCTGGATCGT
GGACGATCCACCCGACTCGGCCGCGGCTGTTGTTACCACCGCTGATGAAGGGGATGGGCCAACCAGATCATCTGGGTTGAACTCATCATGGGAGTAGTCT
CCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGTGCGTGTGTGGCACGGGCGCTCTCATACCCTGTTTCGGCCAGGAAAC
GACTCATCGCAGCCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGTCAGGATCTGTGCGGC
GATTACCTTGAGCCCGATCTGACGATAACTCCCCTGGCTTCTTGCCGGACCTAGCTCGATCCTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGA
ATCCCGAGGCTTCACGTTCAAAGGGACTTCCTGTCCCCGGATCCTCGCCCGCGCTCCCAACATGGTTGCCCCGGAGGGTCCTAAAGTCATGCGTCGGAGC
TCGGACGACGTGTCGGACCCATCCTCCGCCGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCCTAGTGCGCGATC
TTTCTCCGGTGATGGACTTAACTCTGACAAAGTGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACC
AGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCT
TCGATCTGCCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATATACAAACTCGAGATCCTTGTCGGACC
AGCTTGACCTGGACACAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTATTCGTTTCTTCGAC
TAGCGGGGTTGGGTTTAGGTACGGTGTTAGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGCTAGCGGATCTTGA
CTTGCGTCAAGATCCGCAGGGTATCCCGAGTGGACCTGGGGGGATAGAGAGGTTTCTCTTCTAGATCCGGACCCGGATCCACCTCTCTTCCGTCAACAGA
GTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTC
ACTTGAGCATCTTTTTGGGACTCACGGTGAAATCCTGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTCCAAG
AATGCCAGATCCGACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCG
TCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATAAGGTGGAACAGCAGT
GGGAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATACTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTG
CCTTGCGGGTGTGTTCCCTTGCCTTTGCGTTTCCTTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGA