Description :
From Genome Similarity Track
Location :
scaffold_2:178630- 181546
Sequence
2916 bases(100 bases per row)
AGTTAGTGCAGCTTGAAGAAGTCACTTACGATGACTTCCGACACGACCTCAAGTGCGATGGTATTGCGGAGGTCGTGATGCTACAGTCGAAGTAGATTCA
GCGATCTATGTTCATCATCAATTATAGGTGATTTGGTTCTCGAAACATTTCCACAGCGTGTGGAATCACGCACACGACCTGCTATTTTGAAGGTTCTAAT
TGATCCTTGTTTCTCACTTGTAATTGAATCCGAAGATGACATCCTTAGTGTGGAGCCGCCCTCTGATCTTCCACCCGAACGTGAAGTTCGATATGAAATT
GATCGTGAATCTGGTTCAAAGCATGCAGTGCTTGACAGTGGCTAGTATATCGAAGGGGTATTTACTTAAAAGCAAGCTGCTAATTTGGTGAGGGAGAACG
CCCCCTCAAAGCGAGCCGATGTTTTGTGTGCGCAATCCAAATGGTAAATGGCGAATCGCTCACGCCTATAACAAATGTGCAGACGATTCCCGCTCTAATG
CCAGCTCCGCGTAAAGATGTCACCATTTACCGTATATCCGGCTGTATGTAGTTTAGTGTACTTGATTTAGTTGATGTATATTACAAAATATTGATGAGGG
AGGAGGACGTCTCTTTAGCGGCTGTTCGTACACCGTCCAGTAAGCTATGGGAGTAGTATGTGATGCCATAAGGACTACCTAATGCTTCAGCAAGGTTCAT
TTGATTGGTCTCCTATCTGGTTGGACCACTGCGAAGGTATGCATAAACATATGTTGACGATATTTCGTTTCTTCGAAGGGCGAAGATGGCAGATCTGCCG
AAGAATGGCACTTGGAGCACCTCCGTCCAGTGCTACAATGTATGCGCGCACATTCGCTGCAACAAAATGTATTTTCGGTGCTAACGAAGTACCGGTCTTC
CGTTGTTATGTTGGTGAACATGGTGTTTGTGCAGACCCTGAGGAAATCAAAGCAATCATGAAATGACTAACGCAAAGAAAACAAAAGGATTCGAGGAAAA
TGGATTGGTTTGTCCTATTTTCTTGCATTATTTCTCGCGTGACTACGCGGAAATGGTACGCTCACTACTAAACTTGCTGAGGAAGAACGTACCATAGGAG
TAGTCATCCACCTGTGAAAAAGCATTCACTCAAATTAAGAAGCGTTTGATAAAAGCACAATTATTTGCTTTACCAGAGGATACGAAGCCGTATAGCGTGG
TGTGTGATGCTTCTGAGTATGTAATCGGTTGTGCACTATAGCAAACGACTCAGAAGGACACAATCGTTTCAATCGCGACCGCAGAAGCCAGTTAAAAAAG
ATATATCCTGtcaatgacaaggagcttttGACAATAAAATTTGCTCTGGTGAAGTGTTGTGCGCACCTCTTGGGCTCAACTACGTTTGTCATCTACATGT
GTCACCCAATCTACATATATGAATGATTGAGTATCGTCTTCCATGACCAGCTGCAGTTCAATCCCCTCATTTGTCACAGCGGATGGCTCGCTGGttgtca
ttcttcgcagTATACAACTTCACGGTCGCGTACAAACCGAAAATAGAACGTGCTCGCTGACGCATCGtcacgacgtcttgaatatGAGCTAACTCATATG
AGTTATAACGAAACCATGCACTCGATATGATTTGTCGAGCGTATGTGGAGGGTGAACGGTGTGATTTGGTCATCAACGTACTCTCATCGACCGATATGGA
GCTCCACAACATGCTATCGGTCGCTTGAAATCACATATGCATCGTTATGCACTTAAAGGTGGTCTCCTTCACTACGAAGTTGCGCATGGCGATGAGCCAC
GGGGTGTGGCTCTCCACAACTGTGGTGTGAAATACAGGATCTTGTATGAGGCGCATGATACGTTGGTGGCTAGTTACTTTGGCCGTAAGAAGACCTATCA
ATCATCAGTGCTCAGTATTGGTGGCTTTgcatgtacaagtgggttgcacgatacgtgaagacatgCAATGATTGCCTGCGATGTCTGTCAGCGCGTGAAG
ATCGCACGCCACTACGGAGTCTCCCTGTTCCTATTGACTATTGAAAGTCAGTCGCTCTCGTCTCTATATTCGGTTTTCCCGAGAATACTGATGATTACCA
TGGAATGCTCGTCTTCGTCTACTGACTCAATAAGATGGTCTTCATCGCTCCATTTTGCAACTTCATCGAAGCCGAAGGTTCGGCTAGATTGTTCATTAAT
TAGTTTTATGCAATCACGGGTTGCCGGGTGCCATCATCTCCGATCGTGTCATACAATTCACGAGTGACTTTTGGAAAAGATTGTTTCGAATTCTTCGCAC
TCGCTTGGTTATGTCCACAGCGGTATATCCGGAGGCCGATGGGCTAACAGATCGTGCCACCCGAGTGGTCGGTGATGTGTTGAGAAGCTTCAGCGTAAAA
ATTCGCAGTGTGTGGGTCATTTTTAACATTGGTAGAGCTTGATTCGGCTCATTCACCTGCTGCTTGCAACATCCGCAAGTtccgctttgtgcgatgggtA
GTGTTTTGGTGTGATTGGGAGAGGAGCTCGGCAAATTGTTGCCTCCAAAATTGACACAATCAATGATGCGAATATGAAGCGCAAATATATGGACACCCTG
GACTCATCCATCATGAGTCGtgtgaatgtgatcacaTGAGTGCGAGATGAAACGAACAAGGCACAAGATTTAGAAGGAAATACGCAGATAGATGAGATCG
TCAAGGCAAAACGTTTTATTTGTTGAAGAATAGTTCAGAGTAATACTAAGAATCTATCAGATGCGGTCTCAAGCTTGGAGCTCGAAGCTATTGCCTCGCT
CCAGCGGTCCATTCCGAGAAGTGTCATGTCAAGGGAATACTTACACTATCAACCTACCAAGCTGGCTAAGGACCCATCCAACGTTCTGCGTAGGGCTCCT
GAAACCCTGTCATGGC