Description :
From Genome Similarity Track
Location :
Scaffold_72:178626- 182021
Sequence
3395 bases(100 bases per row)
CACAATCTTGGATCCGACTCCCATCCACTTGTTACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGAAT
TGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCGGAACCATTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTCAGCAGA
TCCATGGATCCACCATCTTCAGATCCCCGGGATCCAGTAACCTGACAAACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGGC
CATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAAACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACT
AGAGATCTTGGCAACTGACACTTCATGTAGATCACATGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCA
TAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTG
CTTGGCAGGAACAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGGATCTCGCGACAACGACGACACACGTAGAAG
CAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAACATCCAGCTTCTATGTGTGCTTCCGGGATCCGCACTGCGAGCA
CCTGATTTGTCCTGGCCCGTTTATGAGATCTCGGGGTCTGTACATCCCACGGTCTCCGGGTGCGGTATCGCCAGTACGAGAGTGGTCTCCGGTCTTCGCC
GTACGATCGTTGGGTGCAGTGAGACAGACTCGGCGGTAATCCTCTGGGTCGGATTCCGAACCGTCGGATCCTGATTCGGTTCCTGAGTCGTGCGCCGTGA
CTTGGTGGACACGTCGAGCTGGAGCCGTGGGCGTCGGAGTGTTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGAT
CAACAGCCCGCAGCACTTCTGCGTCTGGAAGACGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAATGATCCACATGCTC
CCGTAGTACCTTGGACCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGCAGATATTCTAGCGGGGATTCATCCGATCTG
CGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCACCAGGAACAAGTGGCAAATCAGGCCACTTG
TTCCTGGTGGATCTGCCTAGCTGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGACAAACACTTCTCAGCATCCGACGCTTGATCTC
TCATGAGGGCCGACTTGACTTTGCTGATCCATGTTTTCACTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGGTCCG
TACCCTCTGGATCGTGGACGATCCACCCGACTCGGCCGCGGCTGTTGTTACCACCGCTGATGAAGGGGATGGGCCAACCAGATCATCTGGGTTGAACTCA
TCATGGGAGTAGTCTCCCTCCACTGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGTGCGTGTGTGGCACGGGCGCTCTCATACCCTG
TTTCGGCCAGGAAACGACTCATCGCAGCCTTCGAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGT
CAGGATCTGTGCGGCGATTACCTTGAGCCCGATCTGACGATAACTCCCCTGGCTTCTTGCCGGACCTAGCTCGATCCTGGCTGGATTGTATCAGATCACG
GGTAGGGCGTACTGAATCCCGAGGCTTCACGTTCAAAGGGACTTCCTGTCCCCGGATCCTCGCCCGCGCTCCCAACATGGTTGCCCCGGAGGGTCCTAAA
GTCATGCGTCGGAGCTCGGACGACGTGTCGGACCCATCCTCCGCCGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGAT
CCCTAGTGCGCGATCTTTCTCCGGTGATGGACTTAACTCTGACAAAGTGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATATCCTC
TGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACC
GGTTCCCTTGGATCTTCGATCTGCCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATATACAAACTCGA
GATCCTTGTCGGACCAGCTTGACCTGGACACAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTT
ATTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGTGTTAGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTT
GCTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGTATCCCGAGTGGACCTGGGGGGATAGAGAGGTTTCTCTTCTAGATCCGGACCCGGATCCACCTC
TCTTCCGTCAACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCC
CCTGGCTCAATCTTCACTTGAGCATCTTTTTGGGACTCACGGTGAAATCCTGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATC
AGCAAAATCTCCAAGAATGCCAGATCCGACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGCCCCCGATGATCCGTGTTCTGCTGAACTTTCCT
CACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATA
AGGTGGAACAGCAGTGGGAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATACTCGAGCTTATGGATCCGGGGCCTAGATCGTGGAT
CTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGCGTTTCCTTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG