Description :
From Genome Similarity Track
Location :
contig_36:178617- 180935
Sequence
2318 bases(100 bases per row)
GGACAGTTTTCGAAACAACCCAGCCTATGATCTCCTGAAGGAATATAAGGACACCGTATTCCGACCGGAGCTACCTGAAGGTTTACCAGAAAAGAGAGAG
ATCGAACATCGGATCGATGTGAAAGATCCCAATCTCGCCATGTATCGTCAACAGTGGCGACAGTCGCCGGAGCAGCAACGAGAAATCGTGAAATGGGTCG
AGGAGATGGTTTCGAAGAAACTCATCCGTCCCAGCATAAGTCCACATGCCGCTCCGACATTTTGTGTCCGAAAACCCGTTGGATGGCGTATCGTCCATGA
TTATCGATACCTGAACACCAACACTATTCGTCAAAGCATTCCCATGACTCGAAAGGAAGATATCCTGGACGTCATGGCTGGAGCTTACTACTTTTCCACC
ATGGACTTGATGTCGGCGTATTATCAAGTTCGTCTGCGGGAAGATGATATCAAGTACACAGCTTTTCAAGCTCCGAATGGACTCTGGGAATATCTCGTGT
TGCCATGGGTGTATGCAATGCTCCTGCACGATGCACCGCTTGACATCCAAACTGTTTCGAGGCTTGGAAGAAACGAGATCTTTTTACGACGACATTTACA
TCTTCACCAAGTCTCGTGACGTCCAAGAGCATCTGCAAGCTCTACGGAAAACGCTGGATATCTTGAGGGACAATAAGTTTACGTGAAACTGGCCAAGTGT
GTCTTCTGTGCGGAGGAGATACCATGTCTGGGTGACTTTGTGGGTCGCAATGGTGTTCGCATGGATCCCACAAGGTCCAAACCATCAAGAACTGGCCGGT
GCCTCGGACACAAGAAGAGCTTCACAGCTTTCTGGGCCTAACAGGCTACGTACAACGTTTCTGTCCGGAATTGCTCGTTGACAGCAAATGTTTGCTTTGT
TGAAGAAGAAGAACAGGCGTAACTCCAAGATCCGCTTCAGCGACGACAGCTGAAGAACTTCAAGGAGTTGAAGCGACGCTTGTGTAATCCACCAGTACTG
CGCTTGCCGGACTTCAGCAAACCAATGCACCTGCGTACCGATGCAAGTAAGTTCGCGGTTGGTGGTGTACTATTCCAAGTCATCGACGGTGTCGAGCAAC
CCATTGCCTATACCAGTCGAAAGATGAAACCAGCGGAGTTAAACTACCCAACGCAGCAACAAGAACTTCTAGCGATTGTGCACGCGCTGGCAGCTTTCCG
AATTTACTGCTTGGATAAACCTCCAGTTATCGAAACTGATCACAAGAGTCTGGAAGGGATTTTCACTCAGAAGATGGCAAATCGTCGGTTGGCACGGTGG
TACGACATCCTCGCAGAATACCAACCACAATTCTCGTATCTGCCTGGAGCGCAAAACGGAATTGCTGACGCCCTGAGTCGACGTCCAGATTTGCAGCCGG
AGACGAAGTACTTTCATGACTTAAGTGTTACCAGCTTCGATGATACTTCATTCCGACTTGAGATAAGTGCGATCACAACGGACAGCGAGCTAATCCATTC
GATTAAAACCGCGTACGCCAAAGATCGAGAAGCTCAAGCGATATTCGATGCTATCCGAAGGCGACGTGAAAGTACGAGCAAGCGTGTCGACCGTCAGCAC
CGGAAGAAGTATCGGTGTTACCATGAAGATCGTGGACTGCTATGGTATCAGACAACCAGCGATGACACACCTCGTGTAGTCGTACCAAACTCGGTCAAGG
TTCGTCAACAGATCATCAGCGAATGCCATGACTCCAATTACGGAGGACACCCAGGTGCTGAGCGAACATATCTCACACTGTCACGTCACTGGTATTGGAC
CAAGATGATCAAATCATCCAGAAGTTCATCGCTGACTGTGAGCCGTGTCGAAGAAATAAACCTCGGCTGACCAAGCCACCCGGACTGTTGGAACCGCTTA
GTATTCCTGAGGAGAGATGGCGATCAATCTCCATGGATTTCATAACAGACCTGCCCCGTACTGCACGGAAAGTGGATTCAATTTGGGTTGTCGTGGATCG
CTTGACGAAGAGATGTCATTTTGTGCCAACAACCAAGACGGTAACTGCTGAAGGTGTTGCTCGTTTGTTCATGGAGAACATCTGGAAGCTTCACGGAATG
CCTACAAGCATAATCTCTGATCGAGACCGTAAATTTGTGTCTTCTTTCTGGCAATACGTCTTCAAATCAATTGGAACGAGCCTGAAGATGACAGTCGCTC
ACCGAGCACAGGGTGATGGCCAAACCGAACGGATGAACGGACCTTGGAGGAGTATCTGCGTTGCTTCGTGGGACCACGGCAAGACGATTGGGACGTGCAT
CTCGCGAATGCCGAGTTT