Description :
From Genome Similarity Track
Location :
Scaffold_397:17861- 21334
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_397-fgenesh-gene-0.3Carbohydrate esterase
Pytir_DAOMBR486snap_masked-pir_contig_397-abinit-gene-0.30TrkA-C domain protein

Sequence
3473 bases(100 bases per row)
CACTCGGCGCGCTCTCGTCGGAGAAGCGCTACTACCCGTTGCTGCTCGTCAAGGCGGCGCGCAAGATCAACCCATTCTGAATAGAAATGGAGTTGGGGGT
TGTGGGGAATTGCTGCACAAATATTAGATCTTTGCATTCGCTCTTTTTGCATGTTGCTTTTGGGAAGAGCCAATGTCACTTTGTTGCGGAACCAATTTCT
CACATTTCGCTTTGCTGATGCACATGAAGCTGATGATGAGCAGTTCAATTCAGATACCTTCAGCGATTGTCAAAAGGTGACCAGCACCAACCATCTTTGA
TTGATGAACACAGTAAGGTGGCCCCTACTCTACCATCACAACGACTGGGAGCTGAGACAACTTGTTTGCAATCGACCACCTTCGACGACGATGGCCAATT
TGCCAGCCTCATTCATGGCAGGCAAGACGAAAGAGACTCTACATACAATTCCTCATTCGGGGAGACGGACAGCGCGACCGTAAGAGCGCACCGAAAATGG
TGGTAAACACTGCTGTCTGACTACCACCCAAGGACCACTCTGCCTGTATTAGGCCTTGCCTAGAGGGTACCATAGTCAGTCGCACTGTCGCCTCTGTAGC
TGGATCGGGGTCGAAAAGGTGAGGTCTGCACAGTGGAGTAAGGAAAAAGTGGACGTTGCTCATGCGCCAATTGCCATGCTCATTTCATAATTCGTTCATT
GATTTGCGGTCACTTCGAATTCAACTCTCTATTAACTACTTACTATTAACGACAGTGGCTGTGTGTGTGGACAAACTCTACACTCTGATTGAAAGAAAAT
AAATGCTACGACTACTCGGTATTTGTGTGTGTGGAGGCGCGCATAAATACAAGTTGCTGTTTTTGCGGGGCTGGACTGGACTGGAATGTGAGGGGAGTGG
GCGACCAAGAAGTGATGATATTTCCGTGCTGTTTGTCGTGCCGCTACTGCTGGAGGAGTGGATGGGGGTTTAAAACTGGGGACACCAACGTCACAGCGAT
CCGCCCACTTAGCTGCTGCTCTTGCGGTTCTTGAACGCGATGACAAAGCCGATGAGCAGGATCGCGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGGCCCTTGGGGTGGGTCTCGGTCTTGGACTCCGCGGTCGTGGACGCCGTGTTGCTCTCGCTCTCGCTCAGCGTCTCAGTGGCGGTGCTGCTC
GCTTTGGAGGAGCTGCTGGTCGGGGTGGTGGTCGTCTCGAGCGCGCGGGCGTTCCCGTCCGCTCGGAGGATGCGCTGTGCGCTGGCAGTAGACGGCGCCA
TCGCAGCTAGGAGCATCAGCGCCAGCGCCAGGAGCAGCACGAGCTTGGCCATGCTCATCGTCTTCCGTGCCATCGTCTAATTCTCTTGTGTGTCTGTGGG
ATAGTTTGTGAGTGTATGTGTGAGAGGCAATGCTAGAAATAGACTGAGAAAACGGGTGGGCAGTTGGGAAGAAAACTCCCACACCACAAACTCTGGCTTT
CTGTAGAAATGCGCCAGAGACAGACTCGGACACAAAAAATGTGGGCTTGAGTCAACATCAAGGATCCACTAAGTGGATAGATTGTCCGCTCGGCCAATCT
TTTTTGCCAATCAAAAACTCTCCACGCTGCTAAAATCTTAAAGAAAATGGCAGGTTTAATTTTGTTAAGACTAAATGGATGGTTTTAGTATTTTATACAA
GGATACGTACATTTTAGATATTACTACTATATTTAATATAAGCAATACAAATTGTAAATAGTTGGATTTTACAATTGCTTCTTGCTTACTTCAAATTTTA
TAGTATTTTTTACTACTTTCATTTGTATTTTTCGGAAATAAATGCGCTCAGTGCCTCTTTTGTATCGACTCGCTGCTGTTGTTAGTCTGGACATTAATAT
GTTCGCGAATGACAAAATTGCGCTCAAATAGGAAGGAATACACACCTCCATACTATTCACTTTCGCCACTATGGACAGCATTTTGGCACAGATTNNNNNN
NNNNNNNNNNNNNNTAGCGGAGCGCCCACTTCCTTCCCAATAAGCCAACACCCAGGAAACCACGAGAGCGACGATGGAGGACGAGCTCGCGGGTCTGCAC
GACGCGTTCACGTTCCTGCTGGAGGGGATTGACCACAAGGACTTCGCACATTGTTTGTATAGATGAATGAGCGATCGCACTGGACAAGTTGTACCGTCAA
CCAACACCCAGCTTACCCAATTCTTCTGTTCTGTTCTTCCTCGTATTCGCGCTGAGCTGCACGCTCCGACATCTGTGGAGAAAACTGAAGAAGGATTAAC
GCGATGCTTTGCGGTTGGTTGGCCCGGTGGCTGGCTGTAAGAGGTAAGAGCGGGGCCAACTCAGCTCTCAGAAGCGGATGGGGATAACCATATGGAGGCG
ACGACCGGATCTCAACCACACGAAAGAGGTGCCACTTGACTTGATGTCTGTTGTTTAACACCTTTTTTGGCTCTGGATGTAATACAAACGAACGAAGGCA
ACCAGTGCAGCTCGAGATTGTGGTCATAATCCCCCAATCCCAATCCTCAGCCATGTGGTTCCGTTAATCAAATCGTGATTATCAGCCGCTCTAGGTCAGC
TCATCCGTCCATCCATCCACCCACGAGTCACACGCCGCCTGACGTAATGAGCGATTCTACGATTCTACCGCACGCATCGCCCACAGCCCCACGAGTCCTC
ACTTCAGAACCGCCTGCGTCCAGGACTCAACACTCTTTCTACAGTGGACGGACAGACGGACGGATTGAGCCACAACTGCATCCGGTCAATCCACATTGTG
ACCAAGCCTGACCCAGGTCCAAGCTTAAGCGTTCGCGTCCGATAGCGCCATGTGTGCACAAATCCCACACATCTCTTATTCTATCGCCGCCTTCACAGTA
TCAGCAGCGACGATGTTTCTGATCAACGTCCCTAGTGCTCACGCTCAACAACGGACCGAGTCTCAGCGTTTCTACCACCCGCGGATGCTCGCAACCGCCA
ACGCGACGTCCTCTATGACGGCCGCGGCGCACGCCGTGCCCTTTGGGACGATGGAGAACGCGGGCGACACGCTCGTACACATCCTGGGCTTCCTCGTGAT
CCTCGTGGCCGCGCACCCGCTGGGATTGCTCTTCCCGCGGCTCTTCCGTTTACCGCTGATCACCGGGTATCTGCTCGTGGGCATCCTCACGGGCCCTTTC
GTCACTGACCTCGTGACGAACGACACCGTGGGGCTGTTGGCCAAGGCTGTGAACGCCATGGCGCTGTCGTTCATCTCGTTCCAGGCCGGCCAAGAGATCT
ACCTGCCGGAGCTCAAGCCGCAGATCCAGGGCATCCTCAAGCTGCTGCTCGTGCTCTACGTAACGGCCATGGCGCTGCTCACGCTTGTGCTCTGGCTCGG
CGCCGGTNNNNNNNNNNCTTCTACGGCGCCTTCGACTCGAGCTGCAAACTTGCGATCGCGCTCATGTTCGGCT