Description :
From Genome Similarity Track
Location :
Scaffold_229:1786- 3839
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_229-snap-gene-0.11Conserved gene of unknown function

Sequence
2053 bases(100 bases per row)
TGCTGCTTGGCATAACTGATGTGTGGTCTGCTATTCGAAAAGAGTGCGCACAGAAAGCAGTCCGCCTCGTGTTCATGCTGCCAGCCATGGAAGCTATTGA
TACGTTTATCGAGCAGCTTCTGCATGTTGCAGTTGGCTCGGAGTACGTGAGAACTCAAGACACGACTCGTCTAACACAATGGAGGGAGCGTGACGGAGCT
CTGTACACTCTTTCGCTCATTCTTAAGTCCATCGAGATTGACGAAAGCTCGCGCGACCTGGGTCGTACGAACGACTTGAGTGCTATTTTAGCGACACGGG
TAGCAAGCGATATCAAAGGAAGATTTTGTGGATCAGAGTCAGCAACTGCTTTCCAGTTTGGAGCCTGCCATACCAACGTCACCCGCCTACCGCGCTCACT
AGCGCAAACATTGAAGCCTGTATTGTACCAATGCTTGCGGCATGACCAGTTGTCGGTGCGAGAAAATGCTGCCCAGTGTCTGAAACAGTACGTCGATCTA
TGCGAGGAGCCCATGCGCTTGGCAATCTTCCAGGAAGTCATCAGCAAGCTGAATCGAATGAAGGAAAGCCACGATGATAACAGCTCTGCGGAACAAGAAT
TACTCGAGACATATGAAGCCGAAGGGCTACTGGATGTGCTTGGAAAGCTGGTACCGTCCCTTCCGTCGCAGTTTCTACTCAAACATTGGAAAATTATTTT
CCCAACTCTAGATAAGTACGTTATGCATATCTCATCAAGTGTCCGGCAAAAGAGCAGTGCAGTAGTCCTGTCGCTGGCCAAACTCACTCGAAAACGCTCC
TGTGACGCGGCTGTGGAGCTTCTTTTGAAGATGCTACTTAGTTTGAGTGAGCAACCCCACGACAGCAACAATTTCTGCTGGCAGCAGAAAGAAGGAAGGC
TGCTGAGCATCGATCTACTTGTCAACTTCTTGGGAAAGGATCTTTTGCTCGGCAAATATGGAACGAAATTGCTGAATTCAGTCACTCAGCAGCACGAATT
GAGGAAAGGGCCGCGGAACTTTGATGAAAAAGAGAATCAATGGGCGAATGTTTACTCTTCCTTGGCTACATGGACAGTCGACGATGACGATATGTTCGAT
TTGAGCGCTTCTTCCGATGGAGACGTGCACGAAAGTGGCCAGCCCCAAAGTGCTCTATCTCTGGTTGACCTGATTAACGAGTTTGCGGAAAAGAAGGCCA
AAAATACAGGGAAATCTGCGGCGAGCGAGTTCTGGCAGCGCGTCCTGACAGGTTGGCTCTGTCAAACGCGCCAAGCGTTTACATCAAACCAATTTGAGCT
TCGCCGAATTTCGCGTCAGATTCTGCCTGGTCTTGTTCGTTTGAGCATATGGCTGAGCCAACAAGAGCTCATCGGATTGGATGAGGCAAATTTCCAGCAG
GTGGATGTTACGTGGTTTTGGTCTTGCTTGAAGTATGTTTTACTTCATCTTCGCTTTCGACAAGAGGCACTGGGAACACTATCTGCAGTAGAGAGCGACG
TGTTGGCTCACGAAGCCACACAAGTCGGGCTCAAATGCGCTTGGAAGTTATTGGAGGCATTGGTGACGACGTTCGATTCTTCTCTTGATGGCTGCACGGC
AGTTGCTGATACTGAGACGACGGTTGTCATTGTGGAAGTTCAATTGATGGCGTTCCTCATGTTCGCTCAATCGCTCGACAATGCAAACCTTATGGTGATG
CTTCTGGAGAAAAGCTTGGGCATCGTTCACCGAAATCTTCCTGCAGACATGCAACTCACTGACCAACGACTACCAAAAAGATCCAGTGATAGCTCTTTAG
ATCGCCAGTTGAGCATCTCGCTTGTGCACATTCTACCAAGTGTTGTGACTACATTTCGCAGTGTGGTGGCTTCTCTTCACGCAGTGAATGGTCAAGCAAA
GCCTAATTTTCTAGGGAATCGATCCGAGAATTGCTGGTGGATTCTGGAGCGCGCAGCTCTCGCCTGGTTAGCCACGGACGACATGTTTCGATGGATTACT
GTTGACCCACGAGAAGCACGCACACTGTTATTGAAGACTCTTGATCAGCTTCT