Description :
From Genome Similarity Track
Location :
Scaffold_127:17859- 21443
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_127-fgenesh-gene-0.11RNA helicase
Pytap_DAOMBR444snap_masked-pag1_scaffold_127-abinit-gene-0.566-pyruvoyl tetrahydrobiopterin synthase

Sequence
3584 bases(100 bases per row)
TCTACCAGCGACGACCGCCGCCACGGCCACCACGGCCACCACCGCGACCATAGTTGCTGCTACCGCCGCCACCACCGAAACGACCAGACATCGCTTCCAa
GTCACGAGGAACTTCCTGTTCTGCCTCGCGAAGGATCTTCACGAGGGGTCCAGCCAGACGACCGTTCTCCTGCGTGAAGAACGAGATGGCGGTACCTTtC
TGGCCGGCACGAGCAGTACGACCAATTCGGTGGATGTAATCTTCGATGTTCTTGGGCATGTCAAAGTTGATGACGTAACGAATATCCTTGATATCGAGAC
CACGAGACGCAACATCCGTCGCAACCAGGATTTGTGTGCGGCCTTCCTTGAACTCCTTCAGCGTCCAGTCACGCTCCTCTTGCGACTTGTTACCGTGGAT
AGCCTTGCAACCGTACCGAGTAGCACGCAGGTTACGGCTCAGCTCGTCAGCACCGCGCTTTGTCTCACAGAAGATAATGATACGGCCGCCCTCGTAGATA
TCCTTCAGGTGGTTCATCAGTGCGTTGTACTTGGAGTAGTCGTCCATCACTTCAATGATCTGCTTGATGCGCTTGTTCGCTGTCAGGTCAAGCGAACCGA
CAGTGACCTGGATAAAGTCCGTAAGGAAGTCGTGGGCGAGCGACACAACTTCCTTTGGCCAAGTAGCAGACCACATGAGGGTCTGACGGTCCGGACGAAT
CTGGCTGACGATCTTGCGAAGCTGAGGCTCGAAACCCATATCAAGCATGCGATCAGCCTCATCTAGCACGAGGTATGTCACGCGACGAAGGTTCGTTTTG
CCCATGCTGAGCATGTCGATCATACGACCCGGCGTACAGATGCAAATCTCAACGCCACGGCGCAAGTCGGCAATCTGAGGGCCCTTCGGTACACCACCAT
AGATGCACGTGTTCTTGATCTTGGAGCTCGAGCCGAACTTGTTACACTCTTGCTGAATCTGGACGGCGAGTTCACGCGTTGGTGCAATGATCAGCACAAT
CGGACCGTCACCTGGCTGGAGGTATGGCTACGAGTACAAACAAATCAAAGTCAGCCCACcACCCCAAAGGATACAGGGAAcAGAAGAAAAGCAGgAAAAC
GGACGCGACAATtAAGTGCCGAGATCGCAGCGAATCACTGAGGCGGCGGACCGAGAGCGAAATCCAGAGAAAGAGAGACGAGCTGCGCAAGCGAGAGAGC
AATCGAGATCGCAATCGCGCGGGAAACTAGCAACAGAGAAACTCGGAGAGAGAATCACCATGTCTCTCCCCCACTCGAGATATCTCGCCTCTTCCTTCAT
CATCGTGTGATATCGATCCGCAAAATTCTCGACGACCCCAAGCGCCCCACAGAAAGAGGCGATTGGtCGTCGAAATGCCTCAGTGGCTGTCACTCGACAC
TACGCGTTCATGCGTAGCACCACaCGCGTCCAATCTCAGCGGATGGAACGAtAGCGAGACAAGTCAATGCCTAAGGTGTGGTGTGCGCGCCACGTGCGCC
CGTTCGCGAAGTGTTGTCCGTTCTGCTCGTCGACAATAGCAATTCAGACACAAACCTGTGCGTTGATGTGGACGATAGCTGGAAGAAGGAAAGCGAGGGT
CTTGCCCGAACCAGTGGCCGAGATACCGACCATGTCGCGACCTGACAGAGCCATCGGCCAGCCCTGACACTGGATCGGCGTCGGCTTGTCGAAGCCCAGG
CGCGTGACCTCCTCGAGCACGTACTCAGGGAACGAcGCCTCCTCGAACGTCAGCACACACTTCGGCACGTtCTTTCCAAAAaCCTGGATGTCATGCTCGC
GCTTCCAGTTCTCGTAGTCCTGCTCTGAACGGCGCGTCACGTCAGGATGCTCGTAGTAAAAGTTCTTCTCGAACACcGGCAGCTTCGACAGGTCCCACTG
GATGTTGGTGTCGAGGTTGGCACCGAGCGCGCCCGAGCCACCACCGCCGAAGCCGCCGCCGCCACCACCACCGTATCCTCCGCCACCGCCACCACCGTAG
CTGCCGCCGCCGCCGTAGCTACCTCCGTAGCCACCACCGCCACTGGAACCACCGCCGTAGCGAGAGGACGACGAGCCGCCGTAGCCGCCAGAGCTGCCAC
CACGCGAGTAGGAGGAAGAGGAGGAGCCGTAGTCACGACGcGAGGACGAGTCCGAGTAGCGGTCGCCGTAGGAGCCACTGCCGCCGCCGTAGCCGCCGCT
CGAGTACATGGCGCTTGGTGTCGGTTGGTCAaGTGCGCAGTCCGTTGGCGGAGGCAAAATggagAGGGgAgAGGATACAGTCCTTCAGGTATGCGGAAAG
AGAGGGATATCGCATAACAGAGGAACTTGCCGgTGGACCGGAAGGGACACAGAGGGTTACGCCATTTCCACCAATCAACGCACGAGACGACCAAAGTAtA
TAGGTATCGGAAATTTCAGATTTAGACGGGTTAAGGCAGAATGGTGCGCTCGTACGACGCCATCTGCTGGTGCGCCTCCGAGATGCTCACTTCGAGCTTG
CGCACGCCACGCTCGAGCAGCGCCACGACACTAAACGCCTCAATGATCTGGTTGCTCTGGTGTATACAGCAATGCATTCATGTCAGAAGCGCGTTGGAAG
CAGTAGAAGAGAGAGGTTGAAAGCCACTTACGATGTAGATGGCGAGCTCTTCGGCTGAAGAGTGCACAATTGGCAGAAGCGAGCAGTCAGCCTTCGGGAA
ACTGCACATGATGGGTGAGTGTGGATGCATAAGCAATACACcGCAGAGCTCAGTCCATACCTGAACTTGGCGTTATCATCCGTGAGGATGTGCACGTTGG
TGCCGTCAAACGTGATCTGCCcAAaCACTGATTAGAACTGCCGGTCATGGAGAGAGTAGGAATCGAAAACGCACCTTGAGCACATCGCTGTTCATTGGAa
CGAGGAACGACTCGTTCAGGTCCTTGCAAATGACGCGAGCAAtCTTTTtGATCTCGCCAAaGTCAACGACATAGCCATCGTGACCGACGACGCCcGTGAT
TGTCACGGCCACGCGGTAGTtGTGGCcGTGGAGCTTCTCACGGAAGCCcTtGTACGCGATGAAGTGCGCCGCGTTAAACTtCATGTAGTCCTTTGACACG
TGTACCTTGAACACCTCATTGTAtCCGGAtGTCAGTGACGGCGTCATACCCCCAATCGTACCCGTCACAAGCTGGCCAGCAGGAGCAATACCAGTGCCAG
GCGCAGGGCTGCCGACAGCAGTGTGCAGTCCGAGTGGTGGCGCAGGAGTCGCGAGGCCAGCAGACACAGCGGCTGTGGTtGCTGGCGTCGCCCCcAcGGC
ACCAGGAACGGCAGCcTGCGTTGGGCGGAATGGCTGGATCTGCGCCTTGACCTCCTCTGGCGTCTTGAGGCAGCCGCGCAGGTGCGAGGCCCATCGGTCG
ACGTTCTTGGACGAGATCtCTTTGTCGCAGTAGCAGCACTTGACGAACCCGTCGGTGGTCGCCTCGCGTGTTACGTTCACCTTGACGATGGCCTTTTGTT
CGGCCGTGAGTTCCTTGGATGCGCCGGCGTTGCTGCCTGTGGACATCCTCTTGGTTCGCTTtcTCTGTGGTCCGACGTTGTCCG