Description :
From Genome Similarity Track
Location :
Scaffold_62:178588- 179831
Transcript NameFunction/comments
Sapdi_VS20SDRG_13683hypothetical protein

Sequence
1243 bases(100 bases per row)
ATTTGCGACGAGTGCCACATACGCAGTGAGGAGGACATGTCAACGGCTTGGCGCTCGGCATCAAGTTGGTTGCGCTCAAGCTGCCGCTTCTCTTCTTGCA
GTCGCTCCAGGTGCTTGTTCATATCGTCCATCTTGCGCTGGAGATCCGTGAACATCCGCGGTTGCGGCGGCGAGCCATCCGAGACAGGCGATTGCAGGTC
GTCTGTGACAAACTCTTTCGTGAGCGCACGAAGCCGCTGGTGCGCGCGATCCGCCACGGCGATTGCCTCGTCGTCCGCCGACGAGCCAGCCCGTCGGTCG
TAGTCGGACGATGATAACATCATGTCGAGCGGCGTCGAATCGTTCGGTACTTGAGTTCGCTTGGCATCGGGGTGCCATTTGTGAATGGCTTTTTGGCTCA
GAAGCAGCTGCGAGCGAGTCGGGGACGTCTGCGACCTCGAGAGTCGCCGCGGCGAGCGAAGGCCGCGCGAGTGCCGCAGACCATCGTTCGAGGAGAGGTC
TGTAAGACGCATACGGTCGGATCGAAGTCGCTGCTCGCTCGACGCTACGCGCTGGGCGATTTCGGCGAGGGACGTCTTGGTCGGCGTAATGTACGCCGAG
CTACCGAGGCTGCTCGACAGCGACGGGGTAGGTGCGTCAAAGTCTTCCATGCTCAGAAAAACCGGGTTGCCTCGTGCTCGATGCTTCCGCGCTTTAATCT
CATGGAGCTCGCTGCGGTGCTTGGCAATCGCCTTGTCGATGTCGTCGCCGCTGTCACCAAAGGGGTCTCCCTCGGTCCCCGTCCGGCTCCGCTGAAGCTC
GTCAGCCAGCCGCGCAATCGTCGGTGGATCATCGTCGCTGCGGATGTCACTCACACTACCCTCGTCCATCGATGGAGCGTCGTCCGTAGCTTCGTCCAGC
TCCTGGGTCCGGTGTTGGCGGTACCTGCTGCCGTCGGCCATCGTATATGGGCGCTTCGATTCGAAGGATTTTGCCGTGTTGAGGCTTGCTGGTTGTATGC
GATGTATTGCTTCGATTCGAAGTACGTTTTGGAATTTACCAATCAGATCGCTCAAACATTACATTCCCTCCGTTTGGACGCCAATCAAATCGCTTCGTGG
GCAAAATCTGCGATCCTGGGATACCACATCCCCGACTTTCTTGGTCCGCTCCAAGGACCAACTGTAGTTACTGGAGTCACCCATGCCAGGGCTTTAAGAT
GCAGTAAGAGTTTCCACCTGGCTAACTTGTAGTTGTCGTCATG