Description :
From Genome Similarity Track
Location :
Scaffold_469:17853- 18940
Transcript NameFunction/comments
Phyci_259621hypothetical protein
Phyci_21649hypothetical protein

Sequence
1087 bases(100 bases per row)
cgctcggcaaatcaagtgcctcgtgaccacagatccagagtccatgccgatagatccgatcgcagtcgctgctcgcactgcggatcccggaagcacacgg
agcttggatgctggaggcgcttgacttgccagaagtgcggcaagagaggccacccgatagatcactgcctcttcgtgtgccgcgggtgcggagagctcca
cgacataggcaagtgtccaatggaggagttctacaactggatccgccggtggtgcaacccgaccaagcacgcggggatgctaccagagaaagccgagaag
atgttaaactaggacgctcaccgcgttggaatcgggtacgagccgagcgttctcggtattgtatctatgcatttgtgaacaagacatcggtagatcaagt
tcgcaagcgaccagatctacaaggtaatacacgagatctacacgggaaacatactgctgtggtctcaagtctctatcaagtcgacgactttgccagatcc
gacgcgacggtgaccgtggatctggatccagagctgccgcaggggtattggaagcaacaggacccggatgtatggttccggcatgcggatggagaagata
ccacatcccagacgcccagatccggccgcgtcgaggcctatcgacgaccccgtgatccggagtcgccagatctccttccaggagagtcccggggctactg
gaagcgacatttgccgggtaagtggttccgactagccaagatcaccggcaagatcaacaatgagaaagcgatcttactcctcgatacaggtgccgaggtg
tccatcgtggacaccgccttttctcgtaaggttgggtgatacatcgacaggatccagagtcaagaatgcgttggaatcggtgacaatgtctacacaacgg
aaggaagaactcggatcaagattaccttagcaggatcactggtgtatttcttcgatatctgggtaggtgatatatctggccaagaagctatcctgggcat
ggacttcatggtcccggccgggatccggctggatctggccgatggatcactctgcctgcccgacgaggtccggatcgagctcagcgg