Description :
From Genome Similarity Track
Location :
Scaffold_3339:1785- 3298
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3339-fgenesh-gene-0.040S ribosomal protein S15a
Pytiw_DAOMBR242034maker-piw_contig_3339-fgenesh-gene-0.1Voltage-gated Ion Channel (VIC) Superfamily

Sequence
1513 bases(100 bases per row)
TGTGTTTTGCGTCTGCAGAATGGTGCGAATGAGCGTGCTTGCCGACTGTCTTAAGACCATCTACAACGCCGAGAAGCGCGGAAAGCGTCAGGTGCTCATC
CGCCCGTCGTCCAAGGTCATCGTCAAGTACCTGCAGGTCATGCAGAAGAACGGTACGTTCCTGTATTTCCACATGGTTTGTCAACATGAGATGCTAATGA
TCACATGGTCTTGTTATTGACAGGCTACATTGGCGAGTTCGAGATCATCGACGACCACCGCGCCGGCAAGATCGTCGTGGAGCTTAAGGGCCGCATCAAC
AAGTGCGGTGTCATCTCGCCGCGCTTCGACGTGAAGATCAACGAGTACGAGAAGTGGATCAACAACCTGCTGCCGTCGCGCCAGTTCGGCCACATCGTCG
TCTCCACCACGTACGGCATCATGGACCACCACGAGGCCCGCCGAAAGCACACGGGTGGCAAGATCATCGGCTTCTTCTACTAGAGAGTACGAGAATCGCC
TGATGGCTTCCACTCACAGACGAGAAGGGATCCAGAACTGAACCAGCTCGCTCTCCTCCGGAAGGTGTAACACATGAATGAAGGTGATCGTTGGGTTATC
AATTTTCTGTTAGTCTAAGTGTTGATGAGACGTCTTGTTGCTTCATTATGACCAACCATTCTTACGAAATGCGGGCAGATCACCTCCGGAGCAGCTTGTC
TCCATGAGCTCTTCCTGCCAGGCATCCGCTATTACGAGAACGAGAGAAACGCATAACTGACCGAGCGCCCAGGCTGCTATTTATGCGCCCGCCCACCCGT
GTTGCGCCGCCGTGGGCTATTAACAGCCTGGCAAAGCAGTTGGCACGGGCGAACCACGACCGCGCGGCTCCATCGATCAATAGCCGCAGCCTCCAGGTCG
AGTTCCACGCAGGCAGGCCGCGTGAATGCCCCGCACCCGACCGTAGCGCACCGCATCTCCCCAAGGCTGAGCCGCGATGCCCCGGAACGAGATCGCGCCC
ATCGACGCCGCGCGCCTGAGCGCCTCGGGCCCAGCGCGTGGCGCCGTGCCGTCCCACAAGAAGAAGGTCGGCATGTTCACAAACGTCGAGGCCGTGACAT
CCCAGGAGCGGCGCACGCAGCTCGTGACGGCGCAGAAGCGCCACTCCAACTTCCAGCTCTTCTACGCCATGTTCGGGCTCGCGCTCATGGTCGTGCAGAT
GGAGTACCTCTGGTTCGCCAACGCCCAGTCGCTCGCGATGCCCTGTCCCGTGCACACCGGCGACCAGTGCCCGCACTGCCGTGAGTCACTCGCAGGTGAC
GTGCCCATCCAGGATGGTCGCATGATCCTCCATGCGCTGCGCGTGCTCATCTCGTTCTCGACCGCGATCCTGCTCTACTACGTCTACCGGTACTACGCGG
CCGAGTGTGAGGTGATGAAGATCAAGAACATCGTGCCGCCGCAGGCCACGCTGCTGAGCTCCTCGCTGCGCCGGAGCCTGCTGCTCGAGCTGCTCGTACT
CGTGGTGCATCCG