Description :
From Genome Similarity Track
Location :
Scaffold_87:17845- 19037
Sequence
1192 bases(100 bases per row)
CAGTCTTGGGAGGCCTTGCGGGAGTCAGCGAATCCCGTATACGACACCGCCTGCGAGTACGCCGACGTCTTCCCGGATGAGATCCCCGCCGAGCTACCGG
CGGATCGTGGGGTTTAGCATGAGATCGACCTCGCGCCAGGTACGAAGTACTGCGTTACCAGACAATGGCCACTTCCGCGTTATCAAGTGAAAGCGATCGA
TGACTTCTTCGAGGGCCGCCGAAAGGTGGGTCACGTGCGTGAGAGTACCTCTCCCCATTCCAGTCCAACGTTCTGTGTGAAGAAAGCTACAGGGGGATGG
CGTATCGTTCACGCATTCAACAAGTTGAATGATGCCACCATCCCCGCGCAGACTCCGATCCCTCGGAAGGACATGGTACTGGACTATATGGCTGGCAGCG
TCATCTACAGCGCCATCGACCTGACCGATGGATTCTATCAGATCCTGATGAGAACATCTGATGTGCCTCTCACCGCTGTAAGTACACCGAGCGGGATGCT
CTGGGAGTGGCTCGTGATGCCACAGGGCCTCAAGAACGCGCCTGCCACCTTTAATCGCATGGTCTCCCATGTGCTTCGCCCGCTTCGAGACTTCGCGCCC
AGTTACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGGGCAACCTCAGTGCCGTGGACGTACATCTAAAACACCTGAGACAAGTCTTCCAGGTGATGC
GAGAGAACAAGCTCTACGCAAACCTGAAGAAATGTGTCTTCTGCGCACCGGAGATTCCGGTGTTGGGATGCTACGTGAGCAAGAACGGTGTGCGCGCGGA
TCCCGAGAAGGTATCGTCTATCTGTGCTTGGCCAACGCGGACAAGCCCCACTGAGTTGCGTCAGTGGCTTGGCATGGCCAATTACTTGCACAAGTACACG
AAGAATTCCGCTGGGTTGATCCAGCCGCTGTCCTCGCTGCTGAAGAAGGACGTGATCTGGGAGTGGAAATCGGACCACCAAGCTGCATTCGACTCGGTAA
AAAAGAGCTTGGCGTCTGCGCCGATACTGAAGCTTGCTGATGACTCAAAGCCATTCCACGTCTTCTGCGACGCGAGCGATTTGCCATCGGCTGTGCGCTG
ATGCAGTCGATGATGACGAACACGAACGCGTATCAGCTATCAGTCGCGCCAACTGAAGCCAGCCGAGAAGAATTACCCAGTCCACGACAAGG