Description :
From Genome Similarity Track
Location :
Scaffold_86:178434- 186300
Sequence
7866 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGGACAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAG
CCCGGTGCTGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCACGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAG
AAGTAGAGCTCGCGATGGACGCGGCTCTTATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGATTGTA
CACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGGCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAG
CGTTCGCGCTTCCTCTCGTGTAAACATGGGAGGCGTGAGCAGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCA
ATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCACCCTTGAAGAGTCGAT
TCAAGTGGCTTTTCAAGAAGAGTACAGTCATCGCCAGGCGCGTACGCCGACCTCAGCGTGGCCTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AACGGATGGAACTCGGATCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCAGAAAGACTCCG
CAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCTCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGGGCGCCCTA
CTGGGGGAGAACTAAGGCCTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGACTTAGCCCCTAAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGC
GGCGGGTTGCTCATAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGA
CGGTTGCTCGTAACAGCAACAAGTTGTCTGATGCTTTGAGAGAAAGCATAGGCAACGGAACGGTATCAGTGCGACTAGTAGGAAGGAAGGTCGTTACTGG
CCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACCGCTCTCGATATGGATCCATATGATATGATCCTGGGC
ATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCACCCTGCGCAGTCCGACAGAGCATTGGTGAGTCATG
TTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCAGCCGGCAGATGCTTGGGAGTCGTCAACGTATATGACGACTCCAA
GGTTGTTTTGATGATGGCTGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACCTAGGTCCACAAGCGGGTAGCTTAGTTCCGCTGACAGCTGCAGCTGCC
ACGAACACTGAGAACAGCATGTTCAGAGTGGGTAGCAGAGTTCCCCTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTG
TGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCCTCCTGTGTGGGTACCATAGTACCACACGAGGCCAC
GAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCTCGACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCG
GATCCAAACTTCGTTCAGATCGACGTCGCCTCAAGCGACTCGAAGTCCAGGGCCCGGGCTCCTACGACAAGGCCGGTGGAAGAGTGTTATCACTTCTTCG
ATGGCGAGACAGGTTTACCCATCAGGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGTC
TTTCCTGACCAACCTCAAGGCTGGCGAAATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGAAGGAGCTGAACTCCTCCTCTGTCTTGGACGAG
AACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGCTCTGAGATTCTCAAGAGCCCCAAAGATCCGGTGTATCCTTTGGTGACGGAGTATG
CGGACGCGGTGAACAAACACCCACCGACCCAACTCCCACACGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAG
GCAATGGCCTCTCCCGCGCGAGCAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCG
ACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTCCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCTCAAACACCGATCC
CACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTTCCAAATCCTGATGCGAGAGAGTGA
CATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCGGCGACGCTCAATCTCCTGG
TGACGCAATTGTTCCGCCCTTTGCGTACCTTTGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGGCGAGGGAGGCAAGACAGCCATGGAGGT
GCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTTCTCGGCAACATCGACAAGTGCGTTTTCGCGTCGACAGAGATCAAAGTT
CTCCGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGATCCAGACAAAGTCAAGGGCATAGCAGCATGGCCGACGCCCCGATCCCCAGAAGGATCTTCGA
AAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGAGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGC
GCTGGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGACCAGTCTCCAAGAGGCCCCTGTCCCGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGT
CGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGGCGACACGGCTCGACAGGAACGAGTCATCTCGTTCCAGACCAGGCAGCTCAAA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATG
TCCACTGCGGACCATCCATAGACAGACGGCCAGACAGAGCGCGTCAATAGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCACGGCAGCACCACGTACGT
GGTCGACGCAGCTTCCCGTTGTTGTGTTTGCACTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGCTCTACTTGAACGGCTTCCGTCACCCCAG
AGTACCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTT
TCGCTGCGAAAACAAGTGGAATACTTTATGGATTCCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGT
ACTCCGACAAACATGGAAGAGGAAACTTAAATATATTTAAAGTGGAGGACTTAGTGTTACTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGT
CGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCACTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACCCGA
CGCTCTATGTTGGACGTCTTAAGCGGTACTTTGATCAGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGTCCCAGCTCCTCGAAGCGAGGGTCGGTCACA
GACGTCGACGACGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGAACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCGTACGAGCGGACCC
CGGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGAAGCAGAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATC
GGACGCAGAGACCCGGCAATCCACCCGCAGATGCAGGCTTCCGACCTCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGACGGGCGAGCTCACCCTGATTC
CTGGCCTGGGCGGCAGCATCACCGTCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCG
GACCCGCAGCCGGAACACTCGGACGAGAGTGGTGTTCGGGAGGCGCCGAGTCCTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATTGAG
AAGTCCACTTCCACGTGGAGCGGATTCTCCAGGAGCAACGGCGTCGCGGTACGCGACAGCTCCTCGTAAAGTGGAGGGGTTATGCCCACTCCGAGAACTC
GTGGAAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGTAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGC
CCGAACGGGGTACGGATGATGAATAAATTCCGTACCCGCGCTCATCCTGAGCGCTGGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCT
GATCAAGTGGACAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCGTTACTCCGTGGGTGAGCACTTA
AGAGTCTCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCAC
CCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTACGGGGGATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGGCAACGAA
CAACTGTTCTTTCTGAACAAGGGCACGTTCATAGATGCCCCTAGAAGTGTGACCGCCCACAAGGCCACAAGGAGCGACGATAAGCTCTAAGAAGAGGTCA
GCTCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGGGTTGATGGCAGCTCCCTGGCTAACGGGTGCCACCACTGAACCCCCACGCACACTCTGGGCAG
CTTGGATATTCTTCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAGCGATAGCACCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTC
ATCCGAGGAGTCGAAGATGCCCCGATGGGAGTGCCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAAAGACTGTACGCTTCTTTGAGTGCTTGGCGCCT
TCGGCTTTAGAGACCTTAGCACGCGCAAGACCCTTGGCAAGCGAGAGACGTTTGCAAGGATTCTGTTCCTCATCGCCACCAGATTTGGGAGTGCCCTTAG
CCGCCTTGACGGCCGGACTCTCAGAGCGCACAGACGTCCTGGGCCTGTGATCACCTTGATCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGCTCACT
GGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGATCATCGTGCGTGCTTTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCACGTTCTACG
AACCGAGGGTTCGGAAGGTTGTCTGGAGAGGCCGAGGGCGACGGGCTGCGGCGCTTGCTTGCTTGCTTGCCCACAGCCGCGTCAGCCGAGGAACCGATCG
CCTCAGAGGCCAACTGAGTAGCCTCCTGACGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTCCCGGCAGCAGCCTTGGAGCGTGT
CTTCGCACCGCTCTTTGCAGTGCCACGAGGCATGGTAAACGGTCGAAGTGAAGACCTAGAAGAAGAGCGCACAAACTGCTGCTCGAGGCTCTAACTGTGA
AGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAAAGCTTGTGACGAACACCTCTTCATTCTGATTGGTCGGTAAAC
CGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTATCCCTAGGTGTACCCTGGTTACACGAAGTGTGACACGTCACACTTCAGAAGTATGACACGTCAT
ACTTTGGGATATTTGGTACAAAGTACCAAGGTCGTTCAAAGCCAGTCATTGGTTAACGGCATTGCATTTCTATAGGTGACTTATAGTTTGTATTAAACCC
AAGCTTTATCTACCTATAAATACACTCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGGGGCCTGTGAACTGCCGTTCA
CTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA