Description :
From Genome Similarity Track
Location :
Scaffold_137:178422- 180231
Sequence
1809 bases(100 bases per row)
TCCCCGCACTCGACGCCAACTTTCGGCGTTCGGAAGCCGAACGGAACGTGGCGTCTAGTTCACGCATATAACAAGCTGAACAACGCATCGGTGCCGGCCC
AAACACCAATCCCACAAAAGGATGCGTTGTTAAACGACATGGCCGGTAGCGTACCGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCCTAT
GCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCATTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAAAGCCCCGGCGACA
TTCACTCGCCTGGTGACGCAACTGTTCCGTCCTTTGCGTACCTTCGTACAAACGTACTTCGACGACATATTCGTCCACAGCCGTGCCGAGGGAGGCAGGA
CGGCCATGGAGGTGCATCTAGAACACCTCCGTCGAGTGTTGGACGTAATGCGAGCAAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACC
AGAGATTAAAGCTCTCGGCTGCTTCGTAATCAACGTGGGTGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCAACGCCCGATCCCAGA
AGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCAGGCTTCGCTAAGCCCTTGTCGGGCCTCCTTTAGAAGGA
CGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGACTTCAAGAGGTCCCTGTCCTGGCCCTGCCGGACGAGACGAAG
CCGTTTAGCGTCGTCTGCGATGCCTCCAACTACGTTATCGGGTGTGCATTGCTGCAGGCCAACACGGCTGGACATGAACGAGTCATCTCGTTCCAGTCCA
GGCAGCTCAAAGCCGCCGAGCGGAATCACCCTGTCCACGACAAGGAGCTCCTGGCAAAAAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTC
CCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGGATGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTATCCTTCTTCGCG
GAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCGAAGCGTCCTGACTACGAGTTGGCCCACATCACACGGG
TGACAACGGATCTTTATGATCGGATACGCATGACGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTCACGGCAGGAACGAGCGCGAAGTC
CGACTGGCTTTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGACCTCCTCTATTACCGGGTGGAGCCCAATGAACCTCCACGGGTG
GTCGTACCCAACGACGAGGATCTAAAGTTCGATGTCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTGTCTGTCGG
TTTCTCAGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTTAAGACATGTGAAAATGTCAGCGGGTTCAAACCCGCAGGGCACTCTTC
GGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGGCTCCCGCCGACGGACACGGCAACACCGAA
ATTTTGGGGGTCGTGTGTCCGGCTGAGCAAGATGGTACATCTTGCTCCGGTCACTGTCACTGTTACGGAGCTATATACACGCGAGGTGGTCGTCGATGTG
TTGTTCCGC